ID: 1003631974

View in Genome Browser
Species Human (GRCh38)
Location 6:7795443-7795465
Sequence TGGGGATCCCTGAACTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003631974_1003631983 -3 Left 1003631974 6:7795443-7795465 CCCTGTTAGTTCAGGGATCCCCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1003631983 6:7795463-7795485 CCAAGGCAGAGGGATGTGGCTGG 0: 1
1: 1
2: 4
3: 41
4: 414
1003631974_1003631984 6 Left 1003631974 6:7795443-7795465 CCCTGTTAGTTCAGGGATCCCCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1003631984 6:7795472-7795494 AGGGATGTGGCTGGACAGAGAGG No data
1003631974_1003631986 17 Left 1003631974 6:7795443-7795465 CCCTGTTAGTTCAGGGATCCCCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1003631986 6:7795483-7795505 TGGACAGAGAGGCAAGGTCCTGG 0: 1
1: 0
2: 3
3: 38
4: 429
1003631974_1003631988 27 Left 1003631974 6:7795443-7795465 CCCTGTTAGTTCAGGGATCCCCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1003631988 6:7795493-7795515 GGCAAGGTCCTGGCTACAAAGGG 0: 1
1: 0
2: 0
3: 15
4: 144
1003631974_1003631979 -7 Left 1003631974 6:7795443-7795465 CCCTGTTAGTTCAGGGATCCCCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1003631979 6:7795459-7795481 ATCCCCAAGGCAGAGGGATGTGG 0: 1
1: 0
2: 4
3: 40
4: 306
1003631974_1003631985 11 Left 1003631974 6:7795443-7795465 CCCTGTTAGTTCAGGGATCCCCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1003631985 6:7795477-7795499 TGTGGCTGGACAGAGAGGCAAGG 0: 1
1: 1
2: 7
3: 79
4: 711
1003631974_1003631987 26 Left 1003631974 6:7795443-7795465 CCCTGTTAGTTCAGGGATCCCCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1003631987 6:7795492-7795514 AGGCAAGGTCCTGGCTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003631974 Original CRISPR TGGGGATCCCTGAACTAACA GGG (reversed) Intronic
900079511 1:845139-845161 TGGAAATCCCTGAAAAAACATGG - Intergenic
900093887 1:932571-932593 TGGTGGTCCCTGAACCCACACGG + Intronic
902544860 1:17183886-17183908 TGGGGCTCCCTGAACTCCCTGGG - Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906047366 1:42842387-42842409 CGGGAATCCATGAACTAAAATGG + Intronic
909190500 1:72543082-72543104 AGGGCATCCTTGAACTCACATGG + Intergenic
911590497 1:99742265-99742287 TGCTGATCCCTGAAATAAAAGGG + Exonic
919806843 1:201385548-201385570 TGGGTGGCCCTGAACAAACAAGG - Intronic
924591016 1:245404415-245404437 TGGGGATCCCTGAGGTGTCAGGG + Intronic
1065233296 10:23621192-23621214 TGGCCATCCCTGCACAAACAAGG + Intergenic
1067784211 10:49230900-49230922 TGAGGCTACCTGAATTAACATGG - Intergenic
1071783850 10:88877784-88877806 TGAGGATCCGTGAAGGAACATGG + Intergenic
1074288982 10:112124162-112124184 TGGGGATCCCTCCAGCAACAGGG - Intergenic
1074663226 10:115688276-115688298 AGGGGATACCTGGACTCACATGG - Intronic
1076211980 10:128656375-128656397 TGGAGATCCCTGAAACAAAATGG - Intergenic
1077128583 11:957235-957257 TGGGGATCCCTGGAGGGACATGG - Intronic
1077298057 11:1835196-1835218 TGGGAATCCCACAACTCACAGGG - Exonic
1077972932 11:7214621-7214643 TTGGGAAACCTGAAATAACATGG - Intergenic
1081658426 11:44873249-44873271 TGAAATTCCCTGAACTAACATGG - Intronic
1083147357 11:60769287-60769309 TGGGGACCCCTGAAAGTACAGGG + Intronic
1083179733 11:60977411-60977433 TGGGGATCCCAGCCCTACCAGGG - Intronic
1086461842 11:87013770-87013792 TGGGGATCCCTGATATCTCAAGG + Intergenic
1091122338 11:133066440-133066462 TTTGGTTCCTTGAACTAACAAGG - Intronic
1091132955 11:133161929-133161951 TGGTTATCCCTGATCTAGCAAGG - Intronic
1092310905 12:7351509-7351531 TGGGAATCCCTAATCTGACAGGG - Intronic
1092930313 12:13309370-13309392 TGGGGATCTCTGACCTCACTGGG + Intergenic
1095749785 12:45697353-45697375 TGGGCATCCCTGCACTCTCAGGG - Intergenic
1098382304 12:69881846-69881868 TGGGGATCCCTGAAGAAATTAGG - Intronic
1103900698 12:124302410-124302432 TGGAGAGCCATGAACTATCAAGG - Intronic
1106716387 13:32392823-32392845 TTGGGATCCCAGAACAAAAAAGG - Intronic
1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG + Intergenic
1111979590 13:95002678-95002700 TTGCGATCGGTGAACTAACAGGG + Intergenic
1112991096 13:105514791-105514813 TGTGCATCCCTGGACTTACAGGG - Intergenic
1113235995 13:108275354-108275376 TGGGTATCACTGACCTAAAAAGG + Intronic
1114201365 14:20524027-20524049 TGAGGATACCTGAAGGAACATGG - Intergenic
1115162442 14:30410861-30410883 TGGGGATCCCAGATCAAAGATGG - Intergenic
1116317075 14:43410731-43410753 TGGGCATCCCTGTACTCTCAGGG - Intergenic
1122112630 14:99512990-99513012 TGGTGACCCCTGAGCCAACACGG - Exonic
1123042693 14:105496854-105496876 AGGGGGTCCCTGAAGTTACAGGG + Intronic
1125063223 15:35449902-35449924 TGCAGATCTCTGAAATAACAAGG - Intronic
1127393454 15:58525391-58525413 AGGGGAGCTCTGAACTAAAAAGG - Intronic
1129465470 15:75722127-75722149 TGGGGAGGCCTGAGCTATCAGGG + Intergenic
1129928966 15:79392956-79392978 TGGGGATCCCTGAAGCCAGAAGG - Intronic
1133281402 16:4667407-4667429 TGGGGAGCCCAGTACTAAAAAGG - Intronic
1134772060 16:16817709-16817731 TGGGCATCAGTGAACAAACAAGG - Intergenic
1135288096 16:21211343-21211365 TGGAGTTCCCTGAAGTCACAAGG + Exonic
1138243331 16:55446580-55446602 TTGGGATTCCTGAACTGAAAAGG + Intronic
1139015402 16:62683947-62683969 TGGGTATCCCTGCACTTTCATGG + Intergenic
1141121715 16:81363759-81363781 TAGCGATCCCTGAACACACAAGG - Intronic
1142467603 17:145143-145165 TGGGGAAGCCTGAAGTAGCACGG + Intergenic
1143143050 17:4753777-4753799 TGGGGTGCCCACAACTAACAGGG - Intergenic
1143966763 17:10761122-10761144 TGGGGACCCCGGCACTCACACGG + Intergenic
1153472987 18:5467930-5467952 TGGGCATCCCTGCACTCTCAGGG + Intronic
1163797891 19:19347859-19347881 TGGGGATCCCAGGGCTAAAAGGG - Intronic
1167512299 19:49901766-49901788 TTGGCATCTCTGATCTAACAAGG - Exonic
1168582899 19:57570151-57570173 TGGGGATACCTGACCCAACCAGG + Intergenic
926758188 2:16252642-16252664 TGAAGATTCCTGTACTAACATGG + Intergenic
929847247 2:45542366-45542388 TGGGCATCCCTGCACTCTCAGGG - Intronic
932011743 2:67984862-67984884 TTGGGAGCTCTGAGCTAACATGG + Intergenic
932658071 2:73627384-73627406 AGGGAGTCACTGAACTAACAAGG + Intergenic
932664698 2:73687421-73687443 AGGGAGTCACTGAACTAACAAGG + Intergenic
940139122 2:150474060-150474082 TGCTGATCCATGGACTAACACGG + Intronic
942987649 2:182161956-182161978 TGGGGATGCCTGATCTACCTTGG + Intronic
946405289 2:219489070-219489092 CGGGGATGCCTGAGCTCACAGGG - Exonic
946709182 2:222488660-222488682 AGGGGAGCCCTGAACTCACATGG - Intronic
1172516609 20:35538673-35538695 TGGGTCTCCCTCAGCTAACAGGG - Intergenic
1174032850 20:47644672-47644694 TGGGGAGTCCTGAAATAAAAGGG - Intronic
1177463016 21:21437544-21437566 TGGGGATCCCTGCATAAACCGGG - Intronic
1178502625 21:33138359-33138381 ATGGGGTCCCTGAACTTACATGG + Intergenic
1178947279 21:36959111-36959133 TGGGCATCCCTGCACTCTCAGGG + Intronic
1183671061 22:39273166-39273188 TGGGGAGCCCAGATCCAACAGGG - Intergenic
949331621 3:2929941-2929963 TGGGGATCCCTGCCCTGGCATGG - Intronic
950602759 3:14049364-14049386 TGGGGGTCCCTGTACTACCAGGG + Intronic
952591986 3:34966867-34966889 TGGACAACCCTTAACTAACAGGG + Intergenic
952959181 3:38579165-38579187 TGGGCATCCCTGTCCTGACAGGG - Intronic
955148281 3:56341789-56341811 TGGTGATCCCTGAAAACACAGGG + Intronic
957147203 3:76440060-76440082 TGGGGAACTCTGAACTACCATGG + Intronic
961345668 3:126261722-126261744 TGGAGGTCCCTGAACTGACTGGG - Intergenic
962626114 3:137227555-137227577 TGGGGATCCCTGAAAATACTTGG + Intergenic
964927366 3:161975368-161975390 TGGGCATCCCTGCACTTTCAGGG - Intergenic
966095819 3:176201707-176201729 TGGGTATCCCAGAACAAAAATGG + Intergenic
970725836 4:19043694-19043716 TGGGGCAACCTCAACTAACAGGG + Intergenic
973272139 4:48271946-48271968 TGGGGAACCCTGATTTAACAGGG + Intergenic
973927312 4:55751854-55751876 TAGGGATGCCTGAAATAAGAAGG + Intergenic
987117975 5:14741447-14741469 TGGGGAACACTGAAGTAACGCGG + Intronic
988473446 5:31562551-31562573 TGGGGAAACCTAAACTAAGACGG - Intergenic
988934389 5:36067562-36067584 TGGTGATCCCTGACCTCACTGGG - Intronic
989047574 5:37287704-37287726 TGGGGATCCCGGATCCCACATGG + Intergenic
989730555 5:44642273-44642295 TGGGCATCCCTGCACTCTCAGGG - Intergenic
992046187 5:72892417-72892439 TGGTGAACCTTGAAATAACAGGG - Intronic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1008516372 6:52323229-52323251 TGGAGATCTCTAAACTCACAGGG + Intergenic
1010739307 6:79481177-79481199 CGGGGATTCCTTAACTACCATGG - Intergenic
1010964735 6:82191839-82191861 TGTGGATCTCAGAACTATCATGG - Exonic
1012447082 6:99317746-99317768 TGGGGATCTCTGTGTTAACATGG + Intronic
1013372886 6:109485149-109485171 TGGGGATACAGCAACTAACAAGG + Intergenic
1016401340 6:143684211-143684233 TGGGCATCCCAGAGGTAACATGG + Intronic
1023009991 7:35917825-35917847 TGAGGGTCACTGAACCAACAGGG - Intergenic
1024080842 7:45853754-45853776 TGAGGGTCACTGAACCAACAGGG + Intergenic
1031753587 7:125610191-125610213 TGGGGTTCCCTGAGCTATGAGGG + Intergenic
1034819380 7:154202698-154202720 GGAGGGGCCCTGAACTAACAGGG - Intronic
1035525994 8:313780-313802 TGGAAATCCCTGAAAAAACATGG + Intergenic
1036638058 8:10564964-10564986 TGGGGGTTCCTGATCTATCAGGG + Intergenic
1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG + Intronic
1042856522 8:73273269-73273291 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1048011225 8:130457891-130457913 TGGAGATCCCTGAAATAACTGGG - Intergenic
1048353995 8:133638642-133638664 TTGTGTTCCCTGAACAAACATGG - Intergenic
1049021879 8:139962744-139962766 TGGGCCTCCCTGAGCTGACAGGG - Intronic
1050941882 9:11471234-11471256 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1051447692 9:17158103-17158125 TGGGTATCCCTTATCTGACATGG - Intronic
1053443541 9:38135050-38135072 TGGGGATCCTCAAACTACCAGGG + Intergenic
1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG + Intergenic
1198375420 X:136034094-136034116 TGGGGATCCCTGATTTAAAGAGG - Intronic
1200500734 Y:3945829-3945851 TGGTGATCCCTGAAAAAAAATGG + Intergenic