ID: 1003631983

View in Genome Browser
Species Human (GRCh38)
Location 6:7795463-7795485
Sequence CCAAGGCAGAGGGATGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 1, 2: 4, 3: 41, 4: 414}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003631974_1003631983 -3 Left 1003631974 6:7795443-7795465 CCCTGTTAGTTCAGGGATCCCCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1003631983 6:7795463-7795485 CCAAGGCAGAGGGATGTGGCTGG 0: 1
1: 1
2: 4
3: 41
4: 414
1003631975_1003631983 -4 Left 1003631975 6:7795444-7795466 CCTGTTAGTTCAGGGATCCCCAA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1003631983 6:7795463-7795485 CCAAGGCAGAGGGATGTGGCTGG 0: 1
1: 1
2: 4
3: 41
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003631983 Original CRISPR CCAAGGCAGAGGGATGTGGC TGG Intronic
900170850 1:1268033-1268055 CCAGGGGAGAGAGCTGTGGCCGG - Intronic
900308675 1:2023219-2023241 CCAAGGGAGAGGCAAGGGGCAGG - Intronic
900438087 1:2640953-2640975 CCAAGGCAGAGGTGTGAGGCTGG + Intronic
901149738 1:7093274-7093296 CCCAGGCAGTAGGATGTGGCTGG + Intronic
901796627 1:11683221-11683243 TCAGGGCAGAGGGCTGGGGCTGG - Intronic
902334023 1:15744611-15744633 CCCAGACAGAGGGATGTGCGTGG - Intronic
902508933 1:16955200-16955222 GCACTGCAGAGGGATGGGGCAGG + Intronic
902701575 1:18175798-18175820 GCAAGGCAGAGGGAAGAGCCGGG + Intronic
902939135 1:19787179-19787201 CTACGGCAGAGGGAGCTGGCTGG + Intronic
903560717 1:24224955-24224977 CCAAGGCTGAGGGGTGTGGCAGG + Intergenic
903656988 1:24955555-24955577 CTAAGCCAGAGGGGTGTGGGTGG + Intronic
903684102 1:25118711-25118733 CAAAGGCAGAAGGATGTTGTGGG + Intergenic
903970411 1:27115204-27115226 CCCAGGCAGAGGGGTGTGTGAGG - Intronic
904314686 1:29652557-29652579 CCAAGGCCAAGGGCTGTGCCTGG - Intergenic
904384477 1:30132422-30132444 CCAAGGCCAAGGGCTGTGCCTGG + Intergenic
904497802 1:30896986-30897008 GGAAGGCAAAGGGATGAGGCTGG + Intronic
904611735 1:31729532-31729554 CCCAGAAAGAGAGATGTGGCTGG - Intronic
905130972 1:35757083-35757105 CCAAGGCAGAGAGGTGAGGGAGG - Intronic
905871175 1:41405369-41405391 CCCAGGGAGAGGGCTGGGGCTGG + Intergenic
906306869 1:44725052-44725074 GCTTGGCAGAGGGATGTTGCAGG - Intronic
907159476 1:52360080-52360102 CCAAGGCAGGGGGAGCTGGAGGG + Exonic
907344017 1:53759226-53759248 CCAAGGCAGAAGGTTGCTGCAGG - Intergenic
907454295 1:54565251-54565273 CCCAGGCAGTGGGATCTGCCGGG - Intronic
907808510 1:57844889-57844911 CCAAGGCTGAAGGAGCTGGCGGG - Intronic
908089331 1:60669938-60669960 CAAAGGCACAGGGATGTTCCGGG + Intergenic
908842407 1:68293370-68293392 ACAAGGCAGAGGGAGGAGGCTGG + Intergenic
910429683 1:87148531-87148553 ACAAGGCAGTGGGATGAGCCAGG - Intronic
910881890 1:91929358-91929380 ACAAGGCAGTGGCATTTGGCAGG + Intergenic
911576152 1:99580859-99580881 CAAAGCCAGTGGGATATGGCTGG - Intergenic
915044468 1:153000395-153000417 CCATCCCAGAGGGAAGTGGCCGG + Intergenic
915472514 1:156134545-156134567 GCAAGCCAGAGGGCTGGGGCTGG + Intronic
916241915 1:162648721-162648743 AAAAGCCAGAGGGATGTGGAAGG + Intronic
917516357 1:175711635-175711657 CCCAGGCAGAGGACTGTGGCCGG + Intronic
917646085 1:177029955-177029977 CCTAGTCAGAGGGAAGTGGGTGG - Intronic
918025162 1:180736848-180736870 CCAAGGCTGAGGGAGCTGACAGG + Intronic
918784821 1:188751455-188751477 CCTGGAGAGAGGGATGTGGCAGG + Intergenic
919742385 1:200988858-200988880 CTGAGGCAGACGGATATGGCAGG - Exonic
920329306 1:205193979-205194001 CCCAGGGTGTGGGATGTGGCAGG - Intronic
922250831 1:223846821-223846843 CCAAGGCCTAGGGAAATGGCAGG + Intergenic
923093655 1:230758042-230758064 CCTGGGCAGATGGATGGGGCTGG - Intronic
924665516 1:246067606-246067628 CCAAGGCTGTGGGCTGTGGGGGG - Intronic
1063046611 10:2398756-2398778 CCATGGCAGATGGATGTGTTTGG + Intergenic
1063962497 10:11318569-11318591 CCAGGAGAGAAGGATGTGGCTGG + Intronic
1064103096 10:12479784-12479806 CCAAGGCAAAGGGACGGGGCAGG + Intronic
1065955063 10:30686255-30686277 CCAAGGCAGTGGGATGTCTCTGG + Intergenic
1067103316 10:43349025-43349047 CCAAGCCAGAGAGATGCGGAAGG + Intergenic
1067756420 10:49009099-49009121 CCAGGGCAGAGGGCAGGGGCGGG - Intergenic
1069903049 10:71716939-71716961 CCCAGACACAGGGATGAGGCAGG - Intronic
1070158535 10:73851377-73851399 CAGAGGCTGAGGCATGTGGCCGG + Intronic
1070756011 10:78993708-78993730 CCGAGGCAGTGGGGGGTGGCGGG + Intergenic
1070820815 10:79353101-79353123 CCAAGCCCAAGAGATGTGGCCGG + Intronic
1071524706 10:86351763-86351785 CCAGTGCAGAGGGATGGGGATGG - Intronic
1073127511 10:101160869-101160891 CAGAGGAAGATGGATGTGGCAGG - Intergenic
1073463725 10:103681532-103681554 CCAAGGCAGGAGGATCTGCCTGG + Intronic
1073727385 10:106249067-106249089 CCAAGGCTGTGGCATTTGGCAGG - Intergenic
1074169573 10:110919478-110919500 CCACGGCAGAGGGGTGGGGCGGG + Intergenic
1074536722 10:114333209-114333231 TCAAGGCAAAGGTATGAGGCTGG - Exonic
1074850884 10:117438771-117438793 CCAAGGCTGAGTGCAGTGGCGGG + Intergenic
1075671413 10:124266094-124266116 CCAAGGCAGAGGTGTGTCCCGGG - Intergenic
1075890000 10:125940281-125940303 CTCAGCCAGAGGAATGTGGCAGG + Intronic
1076109697 10:127851183-127851205 CCAAGGCAGAGGGATGGGTCTGG + Intergenic
1076522105 10:131087806-131087828 CCCAGGCAGAGAGAGGTGGCCGG + Intergenic
1076589942 10:131576040-131576062 CCAGGGCAGAGGGAAAGGGCCGG + Intergenic
1076930134 10:133527005-133527027 CAAATGCATGGGGATGTGGCTGG + Intronic
1078181485 11:9015315-9015337 CCAAGGCAGGGGAGTGTGGTAGG + Intergenic
1078338698 11:10483807-10483829 CCAAGGCAGAGTGACCTGCCTGG - Intronic
1078489596 11:11756906-11756928 CCAAGGCAGATGGGTGTGCTTGG + Intergenic
1078631605 11:13009230-13009252 CCAAGGCCCAGAGCTGTGGCTGG - Intergenic
1079131902 11:17751714-17751736 TCCAGGCAGAGTCATGTGGCCGG + Intronic
1080128935 11:28770472-28770494 CCCAGGCAGAGGCTTGTTGCAGG + Intergenic
1081664779 11:44910379-44910401 CCAAGGCAGATGGAAAAGGCTGG - Intronic
1081703182 11:45164604-45164626 CAAAGGCACAGGGACATGGCTGG - Intronic
1081724827 11:45320978-45321000 CCAAGACAGGGCGATGTGGGAGG + Intergenic
1082000176 11:47389828-47389850 CGAAGCCTGAGTGATGTGGCCGG - Intergenic
1083085058 11:60134328-60134350 TCCAGGCAGAGGGGTGTTGCAGG + Intergenic
1083363453 11:62127508-62127530 TCAAGGGAGAGGGTTGTGGGAGG + Intronic
1083467744 11:62860035-62860057 CTCAGCCAGAGGGATGTGGCAGG + Intronic
1083657836 11:64238234-64238256 CCAGGGCCGAGTGGTGTGGCAGG + Intronic
1083708904 11:64535288-64535310 GCAAAGCAGAGGGTGGTGGCAGG + Intergenic
1083722437 11:64610007-64610029 CAGAGGCAGAGGGCTGTGGGTGG - Intronic
1084183234 11:67456834-67456856 CCAGGGCACAGGGCTGAGGCAGG - Intronic
1084273889 11:68042274-68042296 CCAAGGCAGGGGCATGGGGCAGG + Intronic
1084653569 11:70502653-70502675 CCCAGGCACAGGGGTGAGGCTGG - Intronic
1084673467 11:70621099-70621121 CCAAGGCACCGGGATCGGGCAGG + Intronic
1085018611 11:73191216-73191238 GCAAGGCCTAGGGATCTGGCAGG + Intergenic
1085284212 11:75349694-75349716 TCAGGGCAGATGGATGTGGCTGG + Intronic
1085467930 11:76736866-76736888 CCAGGGCAGTGGGATGGGGAAGG + Intergenic
1088048390 11:105480647-105480669 TCCAGGCAGAGGTCTGTGGCAGG + Intergenic
1088811405 11:113395192-113395214 CCAAGGCGGAGGACTCTGGCTGG + Intronic
1089269129 11:117289426-117289448 TCAAGGCAGAGGCATTTGGTGGG + Exonic
1089492379 11:118892131-118892153 CAATGGCAGAGGGATGCTGCGGG + Intronic
1090329800 11:125922248-125922270 CCAAAGCCCATGGATGTGGCTGG + Intronic
1090619798 11:128550313-128550335 CCAAGGCAGCAGGAGGTGGGAGG + Intronic
1091391036 12:126076-126098 AGAAGGCAGAGGCCTGTGGCTGG - Intronic
1092051334 12:5472761-5472783 CTGTGGCAGAGGGACGTGGCAGG + Intronic
1092067286 12:5601973-5601995 CCAAGGCAGGGGGTGGTGACTGG + Intronic
1092637656 12:10469007-10469029 CCAAGCCAGAGGGCTATGCCTGG + Intergenic
1092802772 12:12187076-12187098 TCAAGGCAAAAGGATGTGGAAGG + Exonic
1094702370 12:32882033-32882055 TCGGGGTAGAGGGATGTGGCTGG + Intronic
1095442907 12:42255794-42255816 CTAAGGAAGAGGTATGTGGGTGG - Intronic
1095908597 12:47403231-47403253 CCTAGGTAGAGGGGTGTGTCTGG - Intergenic
1095990332 12:48029935-48029957 GCAAGGGAGAGGGATGTGTGGGG + Intergenic
1096157056 12:49346654-49346676 ACAAGGGAGAGGGAAGGGGCTGG - Intergenic
1096412710 12:51388784-51388806 TCAAGGCAGAGAGATGCGACAGG - Intronic
1096573534 12:52538899-52538921 CCAACTCAGATGGAGGTGGCAGG - Intergenic
1096594898 12:52688711-52688733 CCAAGGAAGAGAGGTGTGGGTGG - Intergenic
1097938586 12:65279187-65279209 CCAGGAGAGAGGGATCTGGCGGG + Intronic
1098722008 12:73912158-73912180 CGAAGGCAGATGGATCTGGGGGG - Intergenic
1098769993 12:74539903-74539925 CCAAGCCAGACAGATGAGGCTGG - Exonic
1100391009 12:94146921-94146943 CCAGTGCTGAGGGATATGGCAGG - Intergenic
1101270748 12:103141571-103141593 CCAAGGCAGAGTGCAGTGGCGGG + Intergenic
1101440911 12:104703768-104703790 GCAAGGCAAAGGCATGTGCCTGG - Intronic
1101556758 12:105817135-105817157 CCAGACCAGAGGGATGTGGTGGG + Intergenic
1102024247 12:109704486-109704508 CAAAAGCAGAGGGCTCTGGCTGG + Intergenic
1103219279 12:119230117-119230139 CAAAGGCACAGGAATGTGCCTGG + Intergenic
1103377206 12:120466578-120466600 CCAAGGCTGAGTGCAGTGGCTGG + Intronic
1103881848 12:124172387-124172409 CCAAGTCAGAGTGATGTGGCTGG - Intronic
1104729837 12:131098614-131098636 CCAAGGGAGAGGGAAGGGCCTGG + Intronic
1104829993 12:131743803-131743825 CCCAGGCAGAAGTTTGTGGCAGG - Intronic
1107276718 13:38687476-38687498 CGAAGGCAGCGGGCTGTGCCGGG - Exonic
1108319938 13:49279712-49279734 ACAAGGAAGATGGATGTGGAAGG + Intronic
1109246129 13:59956539-59956561 CCCAGGCAGAGGCATGCTGCAGG + Intronic
1110007224 13:70288008-70288030 TCAAGGCAGAGAGATATGGCAGG + Intergenic
1111520068 13:89389774-89389796 CCAAGGCAGAGAGAACTGGCAGG + Intergenic
1111637876 13:90928906-90928928 CCAAGACAGTAGGATGTGCCTGG - Intergenic
1112066434 13:95797972-95797994 ACACGGCAGAGGTCTGTGGCAGG + Intergenic
1113581203 13:111430802-111430824 CCAAGGCAGAGGGAGGTTGTCGG - Intergenic
1114255332 14:20996728-20996750 CAAAATCAGTGGGATGTGGCAGG + Exonic
1114502797 14:23183615-23183637 CGAAACCAGAGGGATGGGGCCGG - Exonic
1114921983 14:27343463-27343485 TCCAGGCAGAGGTATGTTGCAGG + Intergenic
1115908974 14:38234504-38234526 AGAAGGCAGAAGGAAGTGGCTGG - Intergenic
1117841923 14:59869830-59869852 AAAAGGCGGAGGGATGTGGGGGG + Intronic
1117909087 14:60619330-60619352 CCAAGGCAGAGGGCTGTGAATGG - Intergenic
1118750929 14:68807475-68807497 GGAAGGCAGAGCGAGGTGGCAGG + Intergenic
1118859416 14:69650890-69650912 GCAATGCAGAGGGATATGGATGG + Intronic
1121454720 14:94030800-94030822 GCAAGGCAGAGTGATGGGGAGGG + Intronic
1122122504 14:99561954-99561976 CCCAGGAAGAGGGATGAGGAAGG - Intronic
1122319432 14:100845029-100845051 CCAGGGAAGCGGGGTGTGGCCGG - Intergenic
1122364819 14:101188356-101188378 CCAAGGTAGTGGGGCGTGGCGGG - Intergenic
1122420738 14:101575584-101575606 CCAAGGAAGAGAGCTGTGGCTGG - Intergenic
1122806579 14:104262994-104263016 CCAGGGCAGAGGGAGGGGGAAGG - Intergenic
1122952998 14:105056229-105056251 CCAAGACACAGGCCTGTGGCGGG + Intronic
1123708153 15:22965764-22965786 CCAGGGCAGCGGGAAGGGGCTGG - Intronic
1124017476 15:25889518-25889540 CCAAGGCAGAGGAATGTGTGCGG + Intergenic
1124140483 15:27072906-27072928 CCAGAGCAGTGGGCTGTGGCAGG - Intronic
1124601494 15:31136242-31136264 CCAAGGCAGCAGGAGGTGTCTGG + Intronic
1125798327 15:42421342-42421364 CCAGGGCAGAGAGGAGTGGCAGG + Intronic
1126439009 15:48666861-48666883 CCCAGGTAGAGGGATGTGAGTGG + Intergenic
1127215254 15:56817116-56817138 CTAAGGCAGAGGGATGCTCCAGG - Intronic
1127715502 15:61645413-61645435 CCAGGGCCCAGGGCTGTGGCAGG - Intergenic
1129708078 15:77805983-77806005 CCCCGGCAGAGGGCTTTGGCGGG + Intronic
1131511361 15:93051151-93051173 CCGGAGCAGAGGGAAGTGGCAGG + Intronic
1132400422 15:101501796-101501818 CAAAGGCAGAGGGAGGAGCCTGG + Intronic
1132717247 16:1297697-1297719 CCAATGCCAAGGGCTGTGGCAGG + Intergenic
1133306799 16:4814745-4814767 CCAAGGCAGGAGGCTGAGGCCGG + Intronic
1134414119 16:14029083-14029105 CCAAGGCAGGAGGATCAGGCAGG + Intergenic
1135059375 16:19258017-19258039 CCAAGGCAGACGGTTCTGGAAGG - Intronic
1136476273 16:30515593-30515615 CCAGGTGAGAGGGATGTGGCTGG - Intronic
1136783604 16:32922182-32922204 CCAAGGCAGTGGTGTGGGGCTGG + Intergenic
1136886187 16:33931624-33931646 CCAAGGCAGTGGTGTGGGGCTGG - Intergenic
1137731228 16:50691984-50692006 CCAAGGGAGAAGGAGGAGGCAGG - Intergenic
1138117478 16:54372104-54372126 GCAGAGCAGAGGGATGTGACAGG - Intergenic
1138613206 16:58144025-58144047 CCCAGGCAGTTAGATGTGGCTGG + Intergenic
1138691261 16:58770902-58770924 AGCAGGCAGAGGGATGTGGGTGG - Intergenic
1139660812 16:68419491-68419513 CCTAGCCAGAGGGATGGGGCAGG + Intronic
1139661143 16:68421631-68421653 CCAAGTCAAAGAGATGTGTCTGG - Intronic
1140125237 16:72112727-72112749 CCGGGGCAGCGGGAGGTGGCTGG + Exonic
1140744315 16:77967852-77967874 CAAAGGCAGAGGAATGAGGTAGG - Intronic
1141456003 16:84142702-84142724 CCAAAGCACTGGGATGTGACCGG + Intronic
1141478790 16:84292508-84292530 CAGAGGCAGAGAGATGGGGCAGG + Intergenic
1141661449 16:85443788-85443810 CCCAGGCAGAGGGACCTGCCTGG - Intergenic
1141823479 16:86463486-86463508 CCAGGGGTGAGGGATGTGGGGGG + Intergenic
1141981981 16:87556515-87556537 CCAGGGCAGAGGGAGGGGTCAGG + Intergenic
1203086250 16_KI270728v1_random:1186176-1186198 CCAAGGCAGTGGTGTGGGGCTGG + Intergenic
1203141419 16_KI270728v1_random:1769698-1769720 CCCAGAGAGGGGGATGTGGCAGG - Intergenic
1143358159 17:6346382-6346404 GGAAGGCAGAGGGACGTAGCTGG + Intergenic
1143774021 17:9186083-9186105 CCCAGGCAGAGGCCTGTGGGCGG + Intronic
1143921389 17:10333325-10333347 CCAAGGTAGAGGGCTGGGGGTGG + Intronic
1144722475 17:17481069-17481091 CCAAGGCAGGAAGAGGTGGCTGG + Intronic
1145038280 17:19556405-19556427 GCATAGCAGAGGGATGAGGCTGG + Intronic
1145266740 17:21383327-21383349 CCGAGGCAGAGGGTCGGGGCGGG - Intronic
1146265668 17:31451032-31451054 CCAAGGTGGAGGGAAGTGGATGG - Intronic
1147143866 17:38474335-38474357 CCAAGGCAGTGGTGTGAGGCCGG + Intronic
1147254514 17:39174126-39174148 CCAAGGCAAAGGGATGCCCCAGG + Exonic
1147503835 17:40993915-40993937 GCAGGGCTGAGGAATGTGGCAGG + Exonic
1147504270 17:40999671-40999693 GCAGGGCTGAGGAATGTGGCAGG + Exonic
1147632755 17:41942690-41942712 GCAGGGCAGAAAGATGTGGCAGG + Intronic
1148243100 17:46012831-46012853 CCAGGGCCGAGGGAGGTGGGAGG - Intronic
1148699332 17:49578495-49578517 CCAGGTCAGAGTGAAGTGGCAGG + Intronic
1148778694 17:50109912-50109934 ACAAGGCACAGGGAGGTGGGAGG + Intronic
1148938655 17:51187187-51187209 CCAAGGCAGAAGAATGAGGATGG + Intronic
1150243210 17:63652660-63652682 AGAAGGCAGATGGATGGGGCAGG + Intronic
1150318305 17:64188295-64188317 CCAAAGCAGAAGGAGCTGGCAGG - Exonic
1150615365 17:66766402-66766424 CCCAAGCAGAGAGATGTGGTTGG + Intronic
1150677285 17:67255424-67255446 CCATGGCAGGGGGATGGGGGGGG - Intergenic
1151112839 17:71699595-71699617 CCAAGGTTCAGGGATGTGGGAGG + Intergenic
1151200773 17:72466284-72466306 GAAAGGCAGAGGGATGAGGAGGG + Intergenic
1151208837 17:72528568-72528590 CCAAGGAGGAGGGATGATGCGGG - Intergenic
1151661421 17:75521212-75521234 CCTAGGCAGAGGCACATGGCTGG + Intronic
1151951402 17:77356282-77356304 CCAAGGCAGGGAGATGGGGCTGG - Intronic
1152090086 17:78241522-78241544 CAGAGGGTGAGGGATGTGGCTGG - Intergenic
1152090100 17:78241604-78241626 CAGAGGGTGAGGGATGTGGCTGG - Intergenic
1152303563 17:79508799-79508821 CCAGGGCAGAGGGCTGAGGCGGG + Intronic
1152373850 17:79907537-79907559 CAAAGGCTGAGAGACGTGGCGGG - Intergenic
1152602952 17:81274292-81274314 CGAAGCCAGAGGCACGTGGCTGG + Intronic
1152660551 17:81540034-81540056 CCCAGGCTGAGGGAGGAGGCTGG + Exonic
1153323125 18:3792812-3792834 CCAAGGCTGAGGGGTCAGGCAGG - Intronic
1153375333 18:4370619-4370641 CCCCTCCAGAGGGATGTGGCAGG + Intronic
1153544383 18:6191185-6191207 CTGGGGCAGAGGGAGGTGGCTGG + Intronic
1153631309 18:7072927-7072949 CCAAGGCAGAGGGCCGCTGCTGG - Intronic
1155726104 18:29085396-29085418 TCAAGGCACAGGCAGGTGGCAGG - Intergenic
1157166973 18:45366636-45366658 CCTAGGCAGAAGGCTGTAGCTGG - Intronic
1158346363 18:56520681-56520703 CTGAGGGAGAGGGATGTGGAAGG + Intergenic
1159847402 18:73479828-73479850 AGAAGGGAGAGGGATGAGGCAGG - Intergenic
1160505694 18:79425720-79425742 CTAAGGGAGAGGGACATGGCAGG + Intronic
1160964667 19:1741716-1741738 CCAAGGTCGAGAGATGTCGCTGG - Intergenic
1161054225 19:2181823-2181845 CCCAGGCAGAGAGAGGCGGCTGG - Intronic
1161089531 19:2353048-2353070 GCAGGCCAGGGGGATGTGGCTGG - Exonic
1161280886 19:3445291-3445313 CCAGGGCAGGAGGATGTGGCAGG - Intronic
1162016758 19:7850383-7850405 CTGAGGCAGAGGGGTGGGGCAGG + Intronic
1162017062 19:7851646-7851668 CAAAGGCAGTGGGAGGTGGAGGG - Intronic
1162131290 19:8527549-8527571 CCCAGGCAGAGGGGTGGTGCTGG + Intronic
1162620130 19:11836357-11836379 TCAAGGGAGAAGGATGAGGCAGG - Intergenic
1162629410 19:11915247-11915269 TCAAGGGAGAAGGATGAGGCAGG - Intergenic
1162634107 19:11953125-11953147 TCAAGGCAGAAGGATGAGACAGG - Intronic
1162930615 19:13955771-13955793 GCAAGGTGGAGGGGTGTGGCGGG + Intronic
1163104764 19:15116795-15116817 CCCAGGCAGAAGGAGGTGGAGGG - Intronic
1164632887 19:29773266-29773288 CTCATGCAGAGGCATGTGGCAGG + Intergenic
1164898668 19:31899458-31899480 TCAAGGCAGAGTCATGAGGCTGG - Intergenic
1165223962 19:34341029-34341051 ACAAAGCAGAGGGAGGTGGTGGG - Intronic
1165346345 19:35250669-35250691 GCAGGGCAGGGGGATGAGGCTGG + Intronic
1165638583 19:37364587-37364609 TCCAGGCAGAGGGCTGTCGCTGG + Intronic
1165775705 19:38403306-38403328 CCGAGGCAGCGGGAGGGGGCGGG - Intronic
1165893880 19:39130206-39130228 CCCAGGCAGAGGGATCAGGGTGG + Intronic
1166314518 19:41981623-41981645 TCCTTGCAGAGGGATGTGGCTGG - Exonic
1166762675 19:45234690-45234712 CCAAGGCCGAGGGCGCTGGCGGG - Intronic
1166887203 19:45969206-45969228 CAAAGAATGAGGGATGTGGCTGG + Intronic
1166985893 19:46659960-46659982 GAAAGTCACAGGGATGTGGCAGG + Intronic
1167123410 19:47532574-47532596 GCATGCCTGAGGGATGTGGCTGG - Intronic
1167637935 19:50666370-50666392 CCAAGGCTGAGGCCTGAGGCTGG + Exonic
925922419 2:8646698-8646720 CCAGGGCAGTGGGCTGTGGGGGG - Intergenic
926121477 2:10243421-10243443 CCAAGGCAGAGCGGTGGGGTGGG + Intergenic
928427912 2:31193811-31193833 CAAAGGGAGAGGGCGGTGGCAGG + Intronic
928855423 2:35797199-35797221 CCAACCCACAGGCATGTGGCAGG + Intergenic
929342523 2:40838611-40838633 TCTAGGCAGAGGGATGAGGGTGG - Intergenic
931801780 2:65765717-65765739 CCAATCCAGAGGCACGTGGCAGG + Intergenic
931854064 2:66283059-66283081 CCAAGGCAGACTAAGGTGGCAGG - Intergenic
932479211 2:72028580-72028602 CCCAGGCAGCGGGATGTTCCTGG + Intergenic
932706063 2:74026048-74026070 CTAAGGCAGAGAGGTGGGGCAGG + Intronic
933572526 2:84030102-84030124 CTAAGAAAGAGGGATGAGGCAGG + Intergenic
933897621 2:86825492-86825514 CAAAGACAGAGGCTTGTGGCTGG + Intronic
934783080 2:96985370-96985392 CCCAGGCAGAGGGATGTGCTGGG - Intronic
935182920 2:100706244-100706266 CCAAGGCATTGGGTTGTGGATGG - Intergenic
938978971 2:136507649-136507671 CTAAGGCAGAAGGATGGGGTTGG - Intergenic
939259906 2:139793592-139793614 CAAAGGCAGAGTGATGTGTTGGG - Intergenic
939728924 2:145757408-145757430 CCAAGGCAGGGGTATGTTTCCGG - Intergenic
939753746 2:146083721-146083743 CCTATGCAGAGCTATGTGGCAGG - Intergenic
943092945 2:183395800-183395822 TCCAGGCAGAGGTTTGTGGCAGG + Intergenic
945911235 2:215651794-215651816 ACAAAGCAGAGGAATCTGGCGGG - Intergenic
945953060 2:216058219-216058241 CCAAGTGATGGGGATGTGGCTGG + Intronic
946142596 2:217704321-217704343 TTAGGGCAGAGGGAGGTGGCTGG - Intronic
947857360 2:233333252-233333274 CCAGGGCACAGGGATGTGCGAGG - Intronic
948176644 2:235948738-235948760 GCCAGGCAGAGGCATGTGTCAGG + Intronic
948662463 2:239515733-239515755 GCAAGGCACAGGGAGGAGGCAGG - Intergenic
1169442297 20:5642828-5642850 CCAAGCCAGAGGGAAGTAGATGG - Intergenic
1170745959 20:19099158-19099180 CGAAGGCAGCAGGCTGTGGCTGG - Intergenic
1171190403 20:23155159-23155181 CCGGGGCAGGGGGAGGTGGCGGG - Intergenic
1171344069 20:24452526-24452548 CCATGGCAGAAGAATGAGGCAGG - Intergenic
1172639552 20:36432537-36432559 CCAAGGCTGGGGCAGGTGGCTGG - Exonic
1172977768 20:38919465-38919487 CAAAGGCAGAAGGGTGTGGGAGG + Exonic
1173249830 20:41358574-41358596 CCAGGGCAGGGGGACGTGGTAGG - Intronic
1173282220 20:41639015-41639037 GCAAGGCAGGGGCAGGTGGCTGG - Intergenic
1173314400 20:41930588-41930610 CAAAGGCAGAGTGATATGGTTGG - Intergenic
1174042239 20:47708290-47708312 TCCAGGCAGAGGGAATTGGCAGG + Intronic
1174742405 20:53028095-53028117 CCAAGGCAGAGAGAAGAGACTGG - Intronic
1175533351 20:59689801-59689823 CCAGGATACAGGGATGTGGCAGG - Intronic
1175905276 20:62376550-62376572 CCCAGGTGGAGGAATGTGGCAGG + Intergenic
1175940079 20:62533766-62533788 GAAAGGGAGAGGGCTGTGGCAGG + Intergenic
1179174413 21:38997205-38997227 CCAAGGCAGAGGGAGGTGGCTGG - Intergenic
1180651067 22:17377537-17377559 CAAAGGCAGTGGCATGTGCCTGG - Intronic
1181052092 22:20242744-20242766 CCCAGGCCGTGGAATGTGGCAGG + Exonic
1181851919 22:25755500-25755522 CAAAGGCACAGGAAAGTGGCTGG - Intronic
1181983105 22:26780404-26780426 CCAAATCAGAGGCATGTGTCAGG - Intergenic
1182051909 22:27318869-27318891 CCAAGGCTCAGGGATGCAGCTGG + Intergenic
1183843368 22:40519053-40519075 CCAAGCCAGAGTGTAGTGGCAGG + Intronic
1184039705 22:41935561-41935583 CCAGGGCAGAAGGAAGAGGCTGG - Intergenic
1184170896 22:42759187-42759209 CTAAGGCAGAGGGAGCTGGAAGG + Intergenic
1184412555 22:44333297-44333319 CCAAGACAGCGGGAGGTGCCTGG + Intergenic
1184782802 22:46657551-46657573 TCCAGGCAGAGGGAGGAGGCAGG - Intronic
1184931275 22:47682957-47682979 CCAAGCAAGAGGGATGTCCCGGG + Intergenic
1185028027 22:48426612-48426634 CCACGGCAGAGGGAGATGGAGGG + Intergenic
1185196158 22:49470742-49470764 CCAAAGGAGAGGGAGGTGCCTGG + Intronic
949762588 3:7487738-7487760 CCCAGGCAGAGACTTGTGGCTGG + Intronic
950367445 3:12497537-12497559 CCAAGGCTGAGGGCTCTGACAGG - Intronic
951274520 3:20669313-20669335 GCAAAGCAGAGGGATTTGGCAGG + Intergenic
952076877 3:29707719-29707741 CCATGGCAGAGAGAAATGGCAGG - Intronic
953850787 3:46464291-46464313 CCGTGGCAGAGGGTTGTGGAGGG - Intronic
954195154 3:48991940-48991962 CCAAGGCAGAGGGTCCTGGTTGG + Intronic
954275122 3:49536869-49536891 TCAAGGAACAGGGATCTGGCAGG - Intergenic
956152395 3:66257521-66257543 CCGAGGCTGAGGGATGGGCCTGG + Intronic
959564509 3:107820570-107820592 CCAGGCCAGAGCGATGTGGCGGG - Intergenic
960615082 3:119589156-119589178 CCAAGACAGAAGGCTGTGGGAGG - Exonic
961671445 3:128534556-128534578 CCAAGGCTGAGGGAGTGGGCAGG + Intergenic
963021860 3:140879438-140879460 CTGAGGAAGAGGCATGTGGCTGG + Intergenic
963892066 3:150647179-150647201 CCCAGGCAGAGGGATTTGAAAGG + Intergenic
965171635 3:165272778-165272800 ACAATTCAGATGGATGTGGCAGG + Intergenic
965821870 3:172692398-172692420 CCAAGCTAGAGGGCTGTGGCAGG + Intronic
967845911 3:194042652-194042674 CAAAGGCAGATGGAAGAGGCTGG + Intergenic
968454909 4:692797-692819 CCAAGGCTGAAGGAGGAGGCAGG + Intergenic
968934363 4:3602249-3602271 CCAAGGCAGAAAGCTGAGGCGGG - Intergenic
970590415 4:17555255-17555277 GAAAGGCAGAAGAATGTGGCTGG - Intergenic
971201788 4:24515985-24516007 CCCAGGCAGAGGGATGGGAAAGG - Intergenic
973722818 4:53742435-53742457 GCAAGGCAGAGGCATGTCCCAGG - Intronic
974065773 4:57075777-57075799 ACAAGGCAGAGGAATGTGGTGGG + Intronic
979815970 4:125104511-125104533 GCAAGGCAGAGGGAAGGGCCTGG + Intergenic
980100724 4:128539100-128539122 GCGAGGCAGAGAGAGGTGGCTGG - Intergenic
980408992 4:132390202-132390224 CCCAGGCAGAGGTATGCTGCAGG + Intergenic
981011941 4:139933858-139933880 CAAAGGAAGAGGGATGGGGTGGG + Intronic
981429940 4:144646540-144646562 CAGAGACAGAGGGAGGTGGCGGG - Exonic
981906609 4:149928357-149928379 CCCAAGCTGAGGAATGTGGCTGG + Intergenic
981928332 4:150164002-150164024 CCAAGGCAGGAGGATGGGCCAGG - Intronic
982971459 4:161993011-161993033 ACAAGGCGGAGGGGTGTGGAGGG + Intronic
984012167 4:174383781-174383803 CCCAGAGAGGGGGATGTGGCAGG - Intergenic
984999613 4:185471114-185471136 GCGGGGCAGAGGGATGGGGCGGG + Intronic
985505983 5:280560-280582 CCAGGGCAGAGGGGTGGGGAGGG + Intronic
985771136 5:1812130-1812152 CCAAGGTTGAGGGCTGTGTCTGG + Intronic
986775968 5:11013983-11014005 GCAAGGCAGAGCAATGTGACAGG + Intronic
989577974 5:43006659-43006681 CCAAGTCAGAGGTCTGTTGCTGG - Intergenic
990220650 5:53584809-53584831 CCAAGGTGGAGTGCTGTGGCGGG + Intronic
990792473 5:59496620-59496642 CTAAGGGAGGGGGATGTAGCCGG + Intronic
992133561 5:73719601-73719623 CCAAGGCAGGTGGATGTTTCAGG + Intronic
994696612 5:103079772-103079794 CCAAGGAGGAGGGATGTATCAGG + Intergenic
995262655 5:110123303-110123325 CCAAGCCAGAGGGAAGATGCTGG - Intergenic
995310383 5:110703807-110703829 CCAATGCAGAGGACTGTGGATGG - Intronic
995715421 5:115077826-115077848 TTAAAGCAGAGGGAGGTGGCTGG + Intergenic
995907502 5:117143111-117143133 CCAGGGGAGAGGGAAGTGGAGGG - Intergenic
996937728 5:128967230-128967252 CCAAGGCAGGGGGAGGAGGAAGG - Intronic
998128869 5:139641127-139641149 GGAAGGCATCGGGATGTGGCTGG - Intergenic
998503391 5:142652866-142652888 CCAGGGCAGAAGGAAGTGGAGGG - Intronic
998587027 5:143438073-143438095 CCTGGGGAGAGGCATGTGGCTGG - Intergenic
998875953 5:146599556-146599578 CAAAGGCAGAAGGATGAGCCTGG - Intronic
999080425 5:148838388-148838410 CAAAGGCAGAGTGTTGAGGCTGG - Intergenic
999655612 5:153807755-153807777 CCCAGGCAGAGGGGAGGGGCAGG - Intronic
1000586715 5:163108847-163108869 GCAAGGGAGAGAGATGGGGCCGG + Intergenic
1001314647 5:170633565-170633587 CCAGTGCAGAGGAATGTGCCTGG + Intronic
1001487407 5:172129310-172129332 CCACGGCAGAGAGCTGTGGAAGG + Intronic
1001692574 5:173643975-173643997 ACAAGGTAGAAAGATGTGGCTGG - Intergenic
1001874110 5:175184538-175184560 CATAGGCAGAGGGAGGAGGCTGG - Intergenic
1002047475 5:176550025-176550047 CCAGGGCAGAGAGATGTGCAAGG - Intronic
1002157900 5:177297149-177297171 CTCAGGCAGAGGGACGAGGCTGG + Exonic
1002399485 5:178983568-178983590 TCAAGGTAGATGGATGTGGCCGG + Intronic
1002870639 6:1164590-1164612 CCAAGGCAGAGGGATGGCTCGGG + Intergenic
1003631983 6:7795463-7795485 CCAAGGCAGAGGGATGTGGCTGG + Intronic
1005064912 6:21808388-21808410 CCCAGGAAGAAGGATGTGGCGGG - Intergenic
1005987910 6:30885474-30885496 CCAAGCCAGAGGGACGTCGAGGG - Intronic
1006023075 6:31129090-31129112 CCAAGGCTCAGGGCTGTGCCTGG + Intronic
1007597132 6:43058194-43058216 TCAAGGCAGAGGGCTGTTGGAGG + Exonic
1007775406 6:44222078-44222100 CCAAGGCAGAGGGCAGAGGAGGG + Intronic
1008058793 6:46974602-46974624 CCTAGGAGGAGGGGTGTGGCTGG + Intergenic
1008929919 6:56928127-56928149 ACAAGGCGGAGTGATGAGGCTGG + Intronic
1009459839 6:63899344-63899366 TCAAGGCACAGGGTTGGGGCAGG + Intronic
1012005172 6:93704914-93704936 GCAAGGCAGAGGGAGGAAGCAGG - Intergenic
1012142161 6:95637110-95637132 CCAGGGCAGCGGGCTCTGGCAGG + Intergenic
1013350143 6:109298261-109298283 ACAGGGCAGAGGGTTGTTGCAGG - Intergenic
1015782688 6:136886236-136886258 CCAAAGAACAGGGATGTGGAAGG - Intronic
1016280821 6:142416435-142416457 CCAAGACATAGGCATGTGTCTGG - Intronic
1017005759 6:150027226-150027248 AGAAGGCAGAGGGAGGTGGGGGG + Intergenic
1017758844 6:157552594-157552616 CCAAGGCAAGGAGGTGTGGCGGG + Intronic
1017785355 6:157752413-157752435 CTCAGACAGGGGGATGTGGCAGG + Intronic
1018251117 6:161871606-161871628 GCAAGGAAGAGGGCTCTGGCTGG - Intronic
1018861432 6:167713127-167713149 CCCAGGCTCAGGGAAGTGGCTGG + Intergenic
1019132126 6:169884670-169884692 GCACGGGAGAAGGATGTGGCTGG + Intergenic
1019383531 7:740643-740665 CCAAGACAGAGGCGCGTGGCCGG - Intronic
1019493643 7:1326294-1326316 CCAGGGCAGATGGGAGTGGCAGG + Intergenic
1020811481 7:12854770-12854792 GCAAGGCAGTGGGAGGTGGGAGG + Intergenic
1021994600 7:26167391-26167413 ACCAGCCAGAGGGATGTGGTAGG + Intronic
1022509503 7:30926127-30926149 CCACGGCAGTGGGCTGAGGCAGG + Intergenic
1023042154 7:36181231-36181253 TCAAGGCAGTGGGGTGTGGCGGG - Intronic
1023463476 7:40426923-40426945 ACAAGTCAGAAGGATGAGGCAGG - Intronic
1023942114 7:44775900-44775922 CCAAGGCAGGGGGAGCAGGCAGG - Intergenic
1023989274 7:45118513-45118535 CTGAGGCAGAGGAATGGGGCAGG + Intergenic
1024980936 7:55157067-55157089 CCAAGGCAGCTGGCTGGGGCCGG - Intronic
1026848842 7:73712382-73712404 CCCGGGCAAAGGGATGTGCCTGG - Intronic
1026883444 7:73921776-73921798 CCAGGACAGAGAGATATGGCTGG - Intergenic
1026978513 7:74513187-74513209 AAAAGGCAGATGGAAGTGGCTGG - Intronic
1027239047 7:76315416-76315438 CCAAGGCAGAGAGAGTGGGCTGG - Intergenic
1027774183 7:82443950-82443972 GCAAGTCAGAGGGAGGCGGCTGG + Intergenic
1028052111 7:86201778-86201800 CCACCGCAGAGGTATCTGGCTGG - Intergenic
1028842193 7:95440739-95440761 ACAAGGCAGAGGTATGGGGATGG + Intergenic
1029247440 7:99212660-99212682 CCAAGGCAGAAGCTTGAGGCAGG + Intergenic
1029486996 7:100849370-100849392 GCAAGGCAGTGGGATGTGGAGGG + Intronic
1032078320 7:128846522-128846544 CCCAGGCAGAGGGATGAGCGAGG - Intronic
1032647854 7:133845626-133845648 CCATGGCTGAGATATGTGGCAGG - Intronic
1033516333 7:142110492-142110514 CCAAGGTAGAGGCAAGTGGCTGG - Intergenic
1033655971 7:143374701-143374723 CCAAGGCAGGTAGGTGTGGCTGG - Intergenic
1035073289 7:156160182-156160204 CCACGGCAGGGAGATGTGGAAGG - Intergenic
1035402765 7:158577902-158577924 CAAGGGGAGAGGGAGGTGGCCGG - Intronic
1035421211 7:158730145-158730167 CTGAGGCAGTGGGAGGTGGCTGG + Intergenic
1035657314 8:1319881-1319903 CAAAGGCAGAGGGAAGAGACGGG + Intergenic
1036769953 8:11572030-11572052 CCAGGCCAGAGGGGTGTGGGCGG - Intergenic
1038022426 8:23561685-23561707 CCCAGGCAGAGGGCTGGGGCTGG + Intronic
1040855217 8:51942225-51942247 CCAAGGCAGAGGGAAGTGGTGGG + Intergenic
1041147393 8:54891457-54891479 GCATGGGAGAGGGATGTGACTGG - Intergenic
1041751042 8:61261209-61261231 GCAAGGTAAAGGGATGGGGCTGG - Intronic
1042244688 8:66698717-66698739 CCAAGGAATAGGGATGTAGAAGG + Intronic
1045117816 8:99002979-99003001 CCAAGCTAGAGGGCTGTTGCAGG + Intergenic
1045298091 8:100889624-100889646 CAAAGGCACAGAGGTGTGGCGGG + Intergenic
1046334926 8:112772926-112772948 CCAGGAGAGGGGGATGTGGCAGG - Intronic
1046794646 8:118357787-118357809 CCAAGAGAGAGTCATGTGGCTGG - Intronic
1047003511 8:120596120-120596142 ATAAAGCAGAGGGATGTGGATGG + Intronic
1047340551 8:123976525-123976547 AAAAGGCAACGGGATGTGGCAGG + Intronic
1047400032 8:124538666-124538688 CCAAGGCAGAGGGGAAGGGCCGG + Intronic
1047723407 8:127663776-127663798 ACAAGGCAGAGGGATTTGATGGG + Intergenic
1047771984 8:128037106-128037128 CCCAGGCAGTGGGAAGAGGCAGG + Intergenic
1048437002 8:134427456-134427478 CCAAGGCAGAGGGTTGGAGCAGG + Intergenic
1048728823 8:137414545-137414567 CCCAGAGAGGGGGATGTGGCAGG + Intergenic
1048807106 8:138250997-138251019 TCTAGGTTGAGGGATGTGGCTGG - Exonic
1049220885 8:141428331-141428353 CCAAGTGACAGGGATGGGGCAGG - Intronic
1050624618 9:7489587-7489609 TAAGGGCAGAGGGATGTGACTGG - Intergenic
1052989757 9:34512307-34512329 CACAGACAGAGGGATGTGGGGGG - Intronic
1053139698 9:35674894-35674916 ACAAGGCAGAGGGATGAGTGGGG + Intronic
1053199293 9:36141955-36141977 CCAGGGCTGAGGGAAGGGGCTGG - Intronic
1053303252 9:36966465-36966487 TGAAGGCAGAGGCATCTGGCGGG - Intronic
1055392136 9:75834405-75834427 CCAAGGTACAGGGATGGGGTGGG + Intergenic
1055696118 9:78886423-78886445 CCAAGAAATAGGGATGGGGCTGG + Intergenic
1056255481 9:84795155-84795177 CAAAGACAGAGGGAAGTGGGAGG + Intronic
1056436658 9:86581070-86581092 CAAAGGCAGTGGGGTGGGGCAGG + Intergenic
1057764571 9:97905496-97905518 CCAAAGCAAAGGGATGTTACTGG - Intronic
1058149926 9:101452782-101452804 CCCAGGCAGAAGTTTGTGGCAGG + Intergenic
1058951091 9:109904723-109904745 CCAAGCCAGCGGGAAGAGGCAGG + Intronic
1059349953 9:113657254-113657276 TCAAGGCAGGCGGATGTGGACGG - Intergenic
1059423282 9:114205875-114205897 CCGAGGCAGAGGGAGGTGGTGGG + Intronic
1059432633 9:114259217-114259239 ACGAGGGAGAGGGATGGGGCTGG + Intronic
1059450807 9:114370504-114370526 CCCAGGCAGAGCGATGAGGTGGG + Intronic
1059825793 9:118027510-118027532 CCAGGGCAGAAGGAAGGGGCGGG - Intergenic
1060406832 9:123376982-123377004 CCAAGCCAGCAGGAGGTGGCTGG + Exonic
1061847792 9:133397610-133397632 CAAAAGCAGAGGGTTGTGGGAGG - Intronic
1062048287 9:134434362-134434384 CCAGGCCAGTGGGCTGTGGCGGG + Intronic
1062181921 9:135195518-135195540 TCAAGGCAGAGGGACCTGGGTGG - Intergenic
1062463894 9:136672816-136672838 CCAAGGCAGAGGGGGTGGGCAGG + Intergenic
1062627448 9:137449700-137449722 CCGAGGCAGAGAGATGGGGAAGG + Intronic
1185772317 X:2773866-2773888 GGAAGGGAGAGGGAGGTGGCAGG + Intronic
1186288006 X:8066227-8066249 CAAATGCAGAAGGATGTGGGAGG - Intergenic
1187132485 X:16516232-16516254 CCGAGGCAGTGGGATATGCCTGG - Intergenic
1187413405 X:19070623-19070645 CACAGCCAGAGGGAAGTGGCTGG + Intronic
1187504698 X:19869450-19869472 CCATGGCAGAGGGAAGTAGACGG - Intronic
1187929045 X:24277217-24277239 CCATGGCATAGAGATGTTGCTGG + Intergenic
1188107982 X:26165568-26165590 CCAAGGCAGAAAGCTGTGGCAGG - Intergenic
1188111377 X:26198825-26198847 CCCAGGCAGAAAGCTGTGGCAGG - Intergenic
1188864352 X:35296259-35296281 CCTAGGCAGAGGAATTAGGCAGG - Intergenic
1189555382 X:42139293-42139315 CCACGGATTAGGGATGTGGCAGG - Intergenic
1189896164 X:45658820-45658842 TCAAGGCAGAGGTATGTTGCAGG + Intergenic
1192095328 X:68204644-68204666 ACAAGGCAGAGGGAGGTGGTGGG - Intronic
1192626480 X:72733935-72733957 CCCGGAGAGAGGGATGTGGCAGG - Intergenic
1193871580 X:86805127-86805149 CCCAGGCAGAAGCCTGTGGCAGG - Intronic
1195751193 X:108163072-108163094 CTGAGGCAGAGGGAGGTGACGGG + Intronic
1197661660 X:129179815-129179837 CACAGCCAGAGGGATGTGGGAGG + Intergenic
1199144368 X:144348348-144348370 TTAAGGAAGAGGTATGTGGCTGG - Intergenic
1199976697 X:152898479-152898501 GCAAGACAGAGGGATCAGGCTGG - Intergenic
1199999895 X:153054841-153054863 CCAAGGCAGAGGGGCGTGTCTGG - Intergenic
1201064975 Y:10088916-10088938 CAATGGCAGTGGCATGTGGCTGG + Intergenic