ID: 1003631984

View in Genome Browser
Species Human (GRCh38)
Location 6:7795472-7795494
Sequence AGGGATGTGGCTGGACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003631974_1003631984 6 Left 1003631974 6:7795443-7795465 CCCTGTTAGTTCAGGGATCCCCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1003631984 6:7795472-7795494 AGGGATGTGGCTGGACAGAGAGG No data
1003631975_1003631984 5 Left 1003631975 6:7795444-7795466 CCTGTTAGTTCAGGGATCCCCAA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1003631984 6:7795472-7795494 AGGGATGTGGCTGGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003631984 Original CRISPR AGGGATGTGGCTGGACAGAG AGG Intronic
No off target data available for this crispr