ID: 1003631986

View in Genome Browser
Species Human (GRCh38)
Location 6:7795483-7795505
Sequence TGGACAGAGAGGCAAGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 429}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003631981_1003631986 -2 Left 1003631981 6:7795462-7795484 CCCAAGGCAGAGGGATGTGGCTG 0: 1
1: 0
2: 3
3: 31
4: 333
Right 1003631986 6:7795483-7795505 TGGACAGAGAGGCAAGGTCCTGG 0: 1
1: 0
2: 3
3: 38
4: 429
1003631974_1003631986 17 Left 1003631974 6:7795443-7795465 CCCTGTTAGTTCAGGGATCCCCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1003631986 6:7795483-7795505 TGGACAGAGAGGCAAGGTCCTGG 0: 1
1: 0
2: 3
3: 38
4: 429
1003631980_1003631986 -1 Left 1003631980 6:7795461-7795483 CCCCAAGGCAGAGGGATGTGGCT 0: 1
1: 0
2: 7
3: 18
4: 215
Right 1003631986 6:7795483-7795505 TGGACAGAGAGGCAAGGTCCTGG 0: 1
1: 0
2: 3
3: 38
4: 429
1003631975_1003631986 16 Left 1003631975 6:7795444-7795466 CCTGTTAGTTCAGGGATCCCCAA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1003631986 6:7795483-7795505 TGGACAGAGAGGCAAGGTCCTGG 0: 1
1: 0
2: 3
3: 38
4: 429
1003631982_1003631986 -3 Left 1003631982 6:7795463-7795485 CCAAGGCAGAGGGATGTGGCTGG 0: 1
1: 1
2: 4
3: 51
4: 396
Right 1003631986 6:7795483-7795505 TGGACAGAGAGGCAAGGTCCTGG 0: 1
1: 0
2: 3
3: 38
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003631986 Original CRISPR TGGACAGAGAGGCAAGGTCC TGG Intronic
900273785 1:1809849-1809871 AGAACATAGAGGCAAGGGCCAGG + Intronic
900555279 1:3277222-3277244 TGCACAGAGAGGCATGGGGCCGG - Intronic
900626878 1:3612337-3612359 TGGGCAGAGAGGCACTGTCTAGG + Intergenic
900633388 1:3650652-3650674 TGGAGCGTGAGGCAAGGGCCAGG - Intronic
900665867 1:3815173-3815195 TGTACAGTGCGGCCAGGTCCTGG + Exonic
900797383 1:4716880-4716902 TGTACAGAGCGCCAAGGTCAGGG - Intronic
900959009 1:5907524-5907546 GGGACAGAGAGGCAGAGGCCAGG - Intronic
901861857 1:12079561-12079583 TGGAGAAGGAGGCAAGGGCCGGG - Intronic
902085308 1:13855770-13855792 TGCACAGAGAAGCAGGGCCCTGG - Intergenic
902375336 1:16027660-16027682 TGGGCAGGGAGGCAAGAGCCTGG + Intronic
902386305 1:16077937-16077959 TGGGCAGAGAGGCTAGGCCATGG + Intergenic
902518333 1:17001855-17001877 TAGCCAGAGAGACCAGGTCCAGG - Intronic
902806575 1:18864905-18864927 TGGACAGAGAGCCAAAATCCTGG + Intronic
903263762 1:22144343-22144365 TGGGAACAGAGGCAAGGACCAGG + Intergenic
903347733 1:22698016-22698038 TGGAAAGAGAAGCAAGTTCTGGG + Intergenic
903830363 1:26170752-26170774 TGGACAGTGACGCAAGGACTAGG + Exonic
904230992 1:29072104-29072126 TGGAAAAAGAAGCAAGGACCAGG + Intronic
904418748 1:30378173-30378195 TGGCCAGAGAGGCCAGGGCCTGG + Intergenic
905573718 1:39026574-39026596 TGGAGAGAGCGGCAATCTCCAGG - Intronic
905654172 1:39675414-39675436 TGGACCTGGAGGCAAAGTCCTGG - Intergenic
905894646 1:41537580-41537602 TGGAAAGAGAGGAAAGTGCCAGG + Intronic
906091365 1:43182187-43182209 TGGAAAAAGAGGCTAGGACCAGG - Intronic
906213924 1:44028253-44028275 TGGACAGAGAGGCCTGGCCAGGG + Intronic
907567193 1:55446241-55446263 TGGACAGAAAGAGAAGGGCCAGG + Intergenic
907822070 1:57979986-57980008 TGGACAGAGAGGCACTGGTCAGG - Intronic
908185436 1:61648283-61648305 TGTCCATAGAGGCAAGGACCAGG - Intergenic
908495294 1:64688728-64688750 TGGACAGATAGGCTAAGACCAGG - Intronic
908601537 1:65744938-65744960 TGCACAGAGCAGCCAGGTCCTGG - Intergenic
909244945 1:73269654-73269676 TGCACAAAGCAGCAAGGTCCTGG - Intergenic
910596887 1:88990638-88990660 TGGAAAGAGAGCCTAGGTCTAGG - Intronic
910619962 1:89242611-89242633 TGGATAAAGAGGCAAGATCCAGG - Intergenic
912073132 1:105839263-105839285 TGCACAGAGCAGCAAGGCCCAGG - Intergenic
912210696 1:107553773-107553795 TGCACAGAATAGCAAGGTCCAGG - Intergenic
913688485 1:121256330-121256352 TGGACAAAGAGGAAAGTTACAGG - Intronic
914040343 1:144043973-144043995 TGGACAAAGAGGAAAGTTACAGG - Intergenic
914149115 1:145023947-145023969 TGGACAAAGAGGAAAGTTACAGG + Intronic
915109986 1:153557702-153557724 TGGACTGAGAGTCAGGGTGCTGG - Intergenic
916678908 1:167086969-167086991 TGCATAAAGAGGCAAGCTCCAGG - Intronic
916863567 1:168832525-168832547 TGTACAGATAAGCACGGTCCAGG + Intergenic
916873795 1:168946749-168946771 GAGACAGAGAGGCAAGAACCAGG - Intergenic
917028267 1:170664542-170664564 CGGCCAGAAAGACAAGGTCCTGG + Intronic
917511779 1:175674787-175674809 TTGACAGAGAGGAGAGGACCAGG + Intronic
917836045 1:178942283-178942305 TGGACACAGATGAAAGCTCCTGG - Intergenic
917873019 1:179258643-179258665 TGGAAGGAGAGGCAATGTCATGG + Intergenic
917960609 1:180141425-180141447 TGGAGACAGAGGGAAGGTGCTGG + Intergenic
918464352 1:184806454-184806476 TGGGAAGAGAGGCAGGGTCAGGG + Intronic
918886261 1:190198172-190198194 TGCACAAAGTGGCAAGGCCCTGG + Intronic
919788800 1:201276941-201276963 TGGATAGAGAGGCAGGCCCCCGG + Intergenic
920036534 1:203069128-203069150 TTGACAGAGAGCCAAAGCCCTGG - Intronic
920475807 1:206274829-206274851 TGGACAAAGAGGAAAGTTACAGG - Intronic
920520861 1:206624734-206624756 TGGAAAGAGAGGCCATGTTCAGG - Intergenic
920701079 1:208218553-208218575 TCCACAGAGAGGCAAGGAGCTGG + Intronic
921622641 1:217343056-217343078 GGGTCTGAGAGGCAAGGTACAGG - Intergenic
922842113 1:228650983-228651005 AGAAAAGAAAGGCAAGGTCCTGG + Intergenic
923091078 1:230741701-230741723 TGGATAGGGAAGCAAGGTCTGGG + Intergenic
924329638 1:242928879-242928901 TGGCTGGAGAGTCAAGGTCCAGG - Intergenic
1064305046 10:14157978-14158000 TGGACAGAGACATAAGGGCCAGG + Intronic
1065125276 10:22568038-22568060 CGGACAGAGAGCCATGGTCAGGG - Intronic
1066058568 10:31703129-31703151 TGCACAGAGAAGTAGGGTCCTGG - Intergenic
1066083461 10:31955025-31955047 TGCACAGAGAAGCAGGGCCCTGG - Intergenic
1067016391 10:42758770-42758792 GGGACAGACAGGCAAAGTGCAGG + Intergenic
1067686252 10:48467378-48467400 TGGACAGAGAGGCACGGCTAGGG + Intronic
1068012539 10:51471551-51471573 TGGGCACAGAAGCAAGGCCCAGG - Intronic
1068056250 10:52015414-52015436 TGCACAGAGAAGCAGGGTCTTGG + Intronic
1068355856 10:55907455-55907477 TGCACAGAGCAGCAAGGCCCTGG + Intergenic
1068884210 10:62081629-62081651 GAGAAAGAGAGGCAAGGCCCTGG + Intronic
1068972537 10:62974680-62974702 TGCACAAAGCAGCAAGGTCCTGG + Intergenic
1070162661 10:73874972-73874994 TGGGGAGAGAGCCAAGGTCAAGG + Intergenic
1071291942 10:84194883-84194905 TGGCCAGAGGGACATGGTCCTGG + Intronic
1071501141 10:86205002-86205024 GGGAGGGAGAGGCCAGGTCCTGG + Intronic
1073580103 10:104657527-104657549 TGTAAAGAGAGGCAAGGGGCAGG - Intronic
1074123434 10:110510030-110510052 GGAAAAGGGAGGCAAGGTCCTGG + Exonic
1074703071 10:116109536-116109558 TGCCCAGAGAGGCAAGGCCTAGG - Intronic
1074831739 10:117254439-117254461 TGAAGAGAGAGGCAACGTCATGG + Exonic
1075686049 10:124365807-124365829 TGGACAGAGAAGAGAGGACCAGG - Intergenic
1076033327 10:127177575-127177597 TGCCCAGAGAGGCAAGGTCATGG + Intronic
1077179157 11:1204448-1204470 TGGACAGAGACGCAGGGCTCAGG + Intergenic
1077179939 11:1207749-1207771 TGGACAGAGCTGCAAGGCCCCGG + Intergenic
1078516650 11:12028324-12028346 GGGAGGGTGAGGCAAGGTCCAGG - Intergenic
1078745335 11:14108482-14108504 TGGAGAGAGGGCCAAGTTCCAGG + Intronic
1079769701 11:24444263-24444285 TGCACAGAGTAGCAGGGTCCTGG - Intergenic
1081270557 11:41077578-41077600 TGCACAGAGTGGCAGGGCCCTGG + Intronic
1081386602 11:42480070-42480092 TGTACAAAGCAGCAAGGTCCTGG - Intergenic
1083163131 11:60867775-60867797 TGGCCAGGGAGGCAGGGGCCAGG - Intronic
1084994983 11:72967799-72967821 TGGGCAGAGAGGCTGGGTGCGGG + Intronic
1085981409 11:81730802-81730824 TGCACAGAGAAGCAGGGCCCTGG - Intergenic
1086082806 11:82922817-82922839 CTGTCAGAGAGGCAAGGTCTAGG + Intronic
1087059556 11:93964236-93964258 TTGACTGAGAGGCAGGGCCCTGG - Intergenic
1087143044 11:94785169-94785191 TGGATAAAGGGGAAAGGTCCTGG - Intronic
1087255089 11:95944737-95944759 TGCACAAAGAAGCAAGGCCCTGG - Intergenic
1087777400 11:102268815-102268837 TGGGCAGAGATCCAAGCTCCGGG - Intergenic
1089256898 11:117198975-117198997 TGGAGAGAGGGGCAAGGGGCTGG - Intergenic
1089304380 11:117517507-117517529 GGGACAGAGATGCAGGGCCCTGG - Intronic
1089814354 11:121159021-121159043 AGCACAGAGAGGCAGGGACCCGG + Intronic
1090015725 11:123084886-123084908 TGGAAGGAGAGGCAAGGCCTAGG - Intronic
1090063920 11:123487504-123487526 TGGACAGGTAGGCAAGTGCCTGG + Intergenic
1091552862 12:1550104-1550126 TGCACAGAGCAGCAAGGCCCTGG - Intronic
1091653238 12:2325058-2325080 GGGAAAGAGAGCCCAGGTCCAGG - Intronic
1093563405 12:20571600-20571622 TAGACAGAGAGGTAAGATACTGG - Intronic
1094037005 12:26082205-26082227 TGCACAGAGTAGCCAGGTCCTGG + Intergenic
1095413216 12:41946561-41946583 TGCACAGAGCAGCAGGGTCCTGG + Intergenic
1096241888 12:49964050-49964072 TGGAGAGAAAGGCAACATCCTGG - Intronic
1096521812 12:52188767-52188789 TGGAGAGAGAGGCAAGAGGCAGG - Intronic
1097177169 12:57149953-57149975 AGGCCAGAGAGGCAGGATCCTGG + Intronic
1098771623 12:74559883-74559905 TGCACAGAGCAGCAAGGCCCTGG + Intergenic
1099898729 12:88681425-88681447 TGTGCAGTGTGGCAAGGTCCTGG - Intergenic
1100230360 12:92600488-92600510 TGCACAGAGCAGCAGGGTCCTGG + Intergenic
1102223715 12:111212638-111212660 TTGAAATAGAGGCAAGGGCCAGG - Intronic
1103912368 12:124359600-124359622 TAGCCAGAGGGGCCAGGTCCAGG - Intronic
1103917047 12:124381140-124381162 TGGAGAGGCAGGCAGGGTCCAGG - Intronic
1103982540 12:124746002-124746024 TGGAACGGGAGGCAAGGTCGGGG - Intergenic
1105344037 13:19557366-19557388 TGGGCAGGGAGTCAAGGCCCTGG + Intergenic
1105535998 13:21264217-21264239 TGGGCAGGGAGTCAAGGCCCTGG - Intergenic
1107986223 13:45778595-45778617 TGGAAGGAGAAGCAAGGCCCTGG - Exonic
1109054972 13:57535393-57535415 TGTACAGAGGCGAAAGGTCCTGG - Intergenic
1109360691 13:61291863-61291885 TGGACAGTGAGCCAAGGTCATGG - Intergenic
1109364597 13:61339161-61339183 TGGAGGGAGAGGCACGGGCCGGG + Intergenic
1111234674 13:85393260-85393282 TGGAGAGGGAGGCAAGATCCAGG + Intergenic
1112296402 13:98191064-98191086 GGGCCGGAGAGGAAAGGTCCTGG - Intronic
1114069044 14:19093995-19094017 GGGACAGACAGGCAAAGTGCAGG - Intergenic
1114093216 14:19306010-19306032 GGGACAGACAGGCAAAGTGCAGG + Intergenic
1116378431 14:44232681-44232703 TGCACAAAGCGGCAAGGCCCAGG + Intergenic
1117588083 14:57234408-57234430 TACACAGAGAGTCAAGGTCTTGG + Intronic
1117990109 14:61424837-61424859 TGCACAGAGCAGCAGGGTCCTGG - Intronic
1119659753 14:76441861-76441883 GGGACAGTGAGGCAGGGCCCTGG - Intronic
1120407037 14:84103199-84103221 TGTACAGAGCAGCAGGGTCCTGG - Intergenic
1120933826 14:89874274-89874296 TGCACAAAGCAGCAAGGTCCTGG + Intronic
1120947478 14:90012033-90012055 TGCACAAAGCGGCAAGGGCCTGG - Intronic
1121241928 14:92437174-92437196 TGGAGGGAGAGGCAAGGATCAGG - Intronic
1121369333 14:93342402-93342424 TGCACAGAGAAACAGGGTCCTGG + Intronic
1121505218 14:94472066-94472088 GGGACAGATAGCCAGGGTCCTGG + Intronic
1122295207 14:100701651-100701673 AGGACAGAGTGGGAAGGGCCTGG + Intergenic
1122480113 14:102041724-102041746 TGGGCACAGAGGTAATGTCCTGG + Exonic
1123164733 14:106315431-106315453 TGGACAGAGAGGGAAGGGGTAGG + Intergenic
1123397999 15:19956069-19956091 TGGACAGAGAGGAAAGGAAAGGG + Intergenic
1124170581 15:27368937-27368959 TGGACAGATAGTCAAGGGCCAGG + Intronic
1124509105 15:30307026-30307048 TGCACAGAGAAGCTAGGCCCTGG + Intergenic
1125518239 15:40334755-40334777 TGGAGAGGGAGGCCAGGCCCTGG + Exonic
1125551968 15:40551855-40551877 TGAAAAGAGAGGAAAGGGCCAGG + Intronic
1125990941 15:44107247-44107269 AGGACAGAGAGGCAAAGCCAAGG + Intronic
1126273107 15:46845048-46845070 TGCACAGAGCAGCAAGGCCCTGG + Intergenic
1126358671 15:47823120-47823142 TGGTTAGAGAGGCAAGGGCATGG + Intergenic
1127114483 15:55711357-55711379 TTGAGACAGAGGCAAGGTCAAGG - Intronic
1128078156 15:64841345-64841367 CGGACAGAGACCCAAGCTCCAGG + Intergenic
1128499814 15:68220109-68220131 AGGACAGGGAGGCAAGCTCTTGG + Intronic
1129182187 15:73884524-73884546 TGGACAGAGAGGAAGGGTGGGGG + Intronic
1129317052 15:74751317-74751339 TGGATGGAGGGGCAAGGTTCTGG - Intronic
1130053923 15:80506585-80506607 AGGACAGAGAGGGAAGCTCAAGG + Intronic
1130997149 15:88910244-88910266 TGGAGAGGCAGGCAAGGTCCAGG + Intronic
1131253178 15:90844236-90844258 TGTGCAGAGAGGCCAGGTGCAGG - Intergenic
1131495061 15:92901134-92901156 TTGAAAGAAAGGTAAGGTCCCGG - Intronic
1132673134 16:1110009-1110031 GGGACAGAGAGGAAAGGGCAGGG + Intergenic
1133027960 16:2996880-2996902 GGGACAGGGAGGCAGGGGCCAGG - Intergenic
1133045203 16:3084096-3084118 TGCACAGAGCAGCAAGGCCCTGG + Intergenic
1133205035 16:4228106-4228128 TGGTCAGGGAGGCCCGGTCCAGG - Intronic
1135063112 16:19287601-19287623 TGGGCAGAAAGGCAAGATCTTGG - Intronic
1135231845 16:20715984-20716006 TGGAGAGAGAGGCCATGTACAGG - Intronic
1135627343 16:24007658-24007680 TGCACAGAGAGGCGAGCTGCTGG + Intronic
1136061477 16:27729695-27729717 TGGACAGACAGGCAGGGTTTGGG - Intronic
1136533830 16:30887623-30887645 AGTACTGAGAGGCAGGGTCCTGG + Intronic
1138480143 16:57297344-57297366 TGAACAGAGAGACAAGGCCCTGG + Intergenic
1138652650 16:58470307-58470329 TGGACAGAGAGGAAAAGGCCAGG + Intronic
1139083931 16:63561357-63561379 TGCACAGAGCAGCAGGGTCCTGG + Intergenic
1140237785 16:73174370-73174392 TTGACAGCGAGGCAGGATCCTGG + Intergenic
1140481255 16:75264094-75264116 TGGACAGATAGGCACTGTCGTGG - Intronic
1141598270 16:85110491-85110513 TGGGCAGAGATGCAGGGCCCCGG + Intronic
1141975192 16:87511012-87511034 TGCACAGAGCAGCAAGGCCCAGG + Intergenic
1142174830 16:88640315-88640337 AGGACAGGGAGCCAAGGTACAGG - Exonic
1142292329 16:89198842-89198864 TGGAAGGAGAGGCAAAGGCCAGG + Intronic
1142573061 17:887848-887870 AGAACAGAGAGGCAAGGACGTGG + Intronic
1143319748 17:6060358-6060380 TGGACAGAGAAGCAAGCTATTGG + Intronic
1143597222 17:7922547-7922569 TGGGCTGGGAGGCAGGGTCCTGG + Exonic
1145262796 17:21364826-21364848 TGGACACAGAGGCATGAGCCAGG + Intergenic
1145782182 17:27570629-27570651 TGGAGAGGGAGGCAGGGACCTGG + Intronic
1145883536 17:28368180-28368202 TGGACTGAGAGTCAAAGGCCTGG - Intronic
1147240770 17:39089234-39089256 TGGCCAGAGAGGCAGGATCATGG - Intronic
1147257574 17:39191338-39191360 AGGACAGAGGAGCAAGGTTCAGG + Intronic
1147546538 17:41406413-41406435 TGGCCAGGGAGGCAAGGCCCAGG + Intergenic
1148082965 17:44977643-44977665 TGGACAGACAGGCAAGGTGCAGG - Intergenic
1148755874 17:49972693-49972715 GGGGCAGAAAGGCTAGGTCCAGG - Intronic
1148764423 17:50028918-50028940 TGGCCAGAGAGGGCAAGTCCTGG - Intergenic
1150293699 17:63996867-63996889 TGGGCAGAGAGCAGAGGTCCAGG - Intergenic
1150668815 17:67171437-67171459 TGGTAAGAGAGGCAGGGTCAAGG - Intronic
1150977635 17:70106723-70106745 TTACCAGACAGGCAAGGTCCAGG - Intronic
1151483383 17:74383553-74383575 TGGACAGAGAGGCACTGCCCTGG + Intergenic
1151890798 17:76949408-76949430 TGGACAGAGGGGCAGGGGGCTGG + Exonic
1152056159 17:78028545-78028567 TAGACAGTGAGGCAAAGACCTGG + Intronic
1152073747 17:78146565-78146587 TGGACAGAGAGGGAAAGATCTGG + Intronic
1152096097 17:78272571-78272593 TGGACAGAGAGGCATGGAGAGGG - Intergenic
1152290266 17:79436354-79436376 TGGACAGAGGGGCATGGCCCCGG + Intronic
1152630909 17:81410338-81410360 TGGACACAGAGGAGAGGGCCTGG - Intronic
1152885174 17:82845313-82845335 AGGACAGAGAGGAAGGGGCCAGG - Intronic
1152885182 17:82845342-82845364 TGGACAGAGAGGAAGGGGCCAGG - Intronic
1154259906 18:12821757-12821779 TAGACAAGGAGGCAAGGACCAGG + Intronic
1155180203 18:23338736-23338758 TGGGCACAGAGTCAAGGACCCGG - Intronic
1156455969 18:37294359-37294381 TGGACAGAAAGGGAGGTTCCTGG - Intronic
1156856316 18:41785512-41785534 TGGACACGGAGGTATGGTCCTGG + Intergenic
1157140753 18:45103697-45103719 TCGATATAGATGCAAGGTCCTGG + Intergenic
1160102447 18:75935597-75935619 TGGACATGGAGGAAAGGTCCAGG - Intergenic
1161544825 19:4874080-4874102 TGGACAGAGTGGCCAGGGTCAGG + Intergenic
1161821470 19:6533360-6533382 TGGACGGGGAGGGAAGGTGCTGG - Intronic
1162322259 19:9977334-9977356 TTCACAGAGAGGAAGGGTCCAGG - Intronic
1162525336 19:11203333-11203355 GGGACAGAGAGACAATGTCATGG + Intronic
1163218352 19:15897111-15897133 TGCACAGAGAGGCGAGTCCCTGG - Intronic
1163267452 19:16229473-16229495 TGCACAGAGAGGCTAGGCCCAGG + Intronic
1163388596 19:17015716-17015738 TGAAGAGGGAGGAAAGGTCCCGG + Intronic
1163510666 19:17733248-17733270 TGGGCAGGTAGGCCAGGTCCAGG - Exonic
1163765835 19:19162768-19162790 TGCACAGAGAGGCCAGGGCCGGG + Intronic
1165084739 19:33336263-33336285 TGGACAGAGAGGTGATGTCACGG - Intergenic
1165094813 19:33404306-33404328 TGGGCAGAGAGGACAGGGCCAGG + Intronic
1165432460 19:35780615-35780637 TTCACAGAGCGGCCAGGTCCGGG + Exonic
1165446607 19:35860257-35860279 TGGTCAGATGGGCAAGGACCAGG - Intronic
1165810708 19:38610085-38610107 TGGACAGAGAGGACTGGTACAGG + Intronic
1166283675 19:41810806-41810828 TGGACAGGGAGGGAGGGTCATGG - Intronic
1166337553 19:42117371-42117393 GGGGGAGAGAGGCAGGGTCCGGG + Intronic
1166663583 19:44663372-44663394 TGGACAGAGATGGAAGAGCCGGG + Exonic
1167348724 19:48962422-48962444 AGGACAGAGAGGAAGGGACCTGG + Intergenic
1168308904 19:55451221-55451243 TGGAGAGAGAGGCCAGGGCTGGG + Intergenic
925281361 2:2687506-2687528 TGGAGACAGAGGCAGGATCCTGG + Intergenic
925770787 2:7281207-7281229 TGGACCCAAAGGCAATGTCCAGG + Intergenic
925778514 2:7357689-7357711 TGAGCAGAGAGGCCAGGCCCAGG - Intergenic
926400502 2:12491616-12491638 AGGATAGAGAGGCAGAGTCCAGG + Intergenic
926620555 2:15043253-15043275 CGCACAGGGAGGCAATGTCCCGG - Intergenic
928887311 2:36164583-36164605 TGGACAGGCAGGCATGGTGCAGG - Intergenic
929421266 2:41792248-41792270 GCAACAGAGAGGCAAGGTCTGGG + Intergenic
930438462 2:51376997-51377019 TGGACAAAGCAGCAAGGCCCTGG - Intergenic
930864048 2:56105564-56105586 TGTACATAGAGGCAGGGGCCTGG - Intergenic
932580955 2:72992453-72992475 TGGACACAGAGGCATCCTCCAGG - Intronic
933829297 2:86193985-86194007 AAGTCAGAGAGGCAAGCTCCTGG + Intronic
935488071 2:103682604-103682626 TGGACAGAGAGGCAGGGCAATGG + Intergenic
936927102 2:117748629-117748651 CGGGCAGCGAGGCAAGGTCCTGG - Intergenic
937062283 2:118989572-118989594 TGGAGGGAGAGGCAAGGGGCTGG - Intronic
937475683 2:122213192-122213214 TAGACATAGAGACAAGGTCAAGG - Intergenic
939561605 2:143738984-143739006 TGGAAAGAGAGGCTAGAACCAGG + Intronic
941136180 2:161721114-161721136 TGGATAAAGAGTCAAGGCCCTGG - Intronic
941349500 2:164414490-164414512 TGCACAGAGCAGCAGGGTCCTGG + Intergenic
941539537 2:166765358-166765380 TGGCCAGAAAAGCAAGTTCCTGG - Intergenic
942181866 2:173387897-173387919 TGGACAGAGAGGTAAGGAGGTGG + Intergenic
942251294 2:174049500-174049522 TGGCCAGAGAGGAAAGATACCGG - Intergenic
943324990 2:186486656-186486678 TGGGCGGAGAGGCAAAGCCCAGG - Intronic
943814268 2:192231840-192231862 TTGTCAGAGAGGCAAGTTCTTGG + Intergenic
944483292 2:200178755-200178777 AGGGCAGAGAGGCAAGGCCTAGG - Intergenic
946353315 2:219169482-219169504 TGGAGAGAGGGGCAGAGTCCTGG - Intronic
946475104 2:219999621-219999643 TGGAAATAGAGGCCAAGTCCCGG - Intergenic
948002007 2:234575751-234575773 TGGAGAGAGAGGCTGGGTCTTGG + Intergenic
948183566 2:236001611-236001633 AGGACACAGAGGCCAGGGCCGGG + Intronic
948803792 2:240444391-240444413 TGGACAGTGCCGCAGGGTCCTGG - Intronic
948850788 2:240704375-240704397 GGGTCAGAGAGGCATGGTCAAGG - Intergenic
949023770 2:241755433-241755455 GGCACAGAGTGGCAAGGGCCAGG - Intronic
1169132122 20:3171738-3171760 TGAACTGAGAGGAAAGGTCACGG + Intronic
1170122761 20:12928036-12928058 TGGAAGGAGAGGGAAGGGCCAGG + Intergenic
1170477756 20:16733096-16733118 TGGACAGAGAGCCAAGGGCCAGG + Intronic
1171768041 20:29300856-29300878 TGCACAGACAGGCAAGGCCAGGG + Intergenic
1172377469 20:34456345-34456367 GGGACAGAGAAGCAACTTCCGGG - Intronic
1173427399 20:42954985-42955007 AGGACAAAGAGGGAAGGGCCAGG + Intronic
1174737963 20:52983881-52983903 GGGACAGAGTTGCCAGGTCCTGG - Intronic
1175973687 20:62699667-62699689 TGGCGAGAGACGCAAGCTCCCGG - Intergenic
1175987326 20:62770560-62770582 TGGGCAAAGGGGCAAGCTCCTGG + Intergenic
1176141448 20:63546793-63546815 TGGCCAGCCAGGCAGGGTCCTGG + Intronic
1176451861 21:6869898-6869920 TGGACACAGAGGGGAGGTCAAGG + Intergenic
1176744681 21:10640809-10640831 TGGACAGAGAGGAAAGGAAAGGG + Intergenic
1176830033 21:13734949-13734971 TGGACACAGAGGGGAGGTCAAGG + Intergenic
1176934123 21:14846429-14846451 TGCACAAAGAAGCAAGGCCCTGG + Intergenic
1177206388 21:18016214-18016236 TGCACAGAGCAGCAAGGCCCTGG - Intronic
1177267781 21:18806821-18806843 TGGAAAGAAAGGCAATTTCCAGG - Intergenic
1178496510 21:33090700-33090722 TGGTCAGAGAGGCATGGGGCCGG - Intergenic
1179240003 21:39581591-39581613 TGGCCAGTGGGGCAAGGTCTAGG + Intronic
1180197386 21:46206047-46206069 TGGTCAGGGAGGCAGCGTCCGGG - Intronic
1180215191 21:46319010-46319032 TGGCCACTGAGGCAAGTTCCTGG - Intronic
1180487517 22:15816555-15816577 GGGACAGACAGGCAAAGTGCAGG - Intergenic
1180694286 22:17742129-17742151 TGGAAAGAGGGGCAAGGTAGAGG - Intronic
1180939125 22:19645359-19645381 TAAAAAGAGAGGCAAGGCCCTGG - Intergenic
1182103052 22:27670954-27670976 GGGCAAGAGAGGCAGGGTCCTGG - Intergenic
1182271653 22:29157642-29157664 TGGCCACAGAGGCAAAGTCATGG - Intronic
1182698175 22:32210143-32210165 GGGACAGAGACGCAAGGTCTGGG + Intergenic
1184884900 22:47337385-47337407 TGGGGAGAGAGTCAAGGTCAGGG - Intergenic
1185129072 22:49027402-49027424 GCGACAGAGAGCCAAGCTCCGGG + Intergenic
1185211572 22:49573514-49573536 GGGACATGGAGGCAAGGCCCAGG + Intronic
1185215069 22:49594109-49594131 GGGACAGAGAAGGAAGGTCTGGG - Intronic
1185383921 22:50522969-50522991 TGCGGAGAGAGGCAAGGCCCTGG - Intronic
949994041 3:9602335-9602357 GGGAAAAGGAGGCAAGGTCCTGG + Intergenic
950091646 3:10299937-10299959 AGGACAGAGAGGCCATGGCCTGG - Intronic
951543920 3:23806884-23806906 GGGGCAGGGAGGGAAGGTCCCGG - Intronic
951597576 3:24334824-24334846 TGTACAGAAAGACATGGTCCAGG - Intronic
951926270 3:27911995-27912017 GAGACAGAGAGGGAAGGACCAGG - Intergenic
953185137 3:40630527-40630549 TGAGCAGAGAGGCAAGCTCAAGG - Intergenic
953611551 3:44451187-44451209 AGGACAGAGAGCTAAGGGCCAGG + Intronic
954451301 3:50573130-50573152 TGGGCAGTGAAGCAAGGACCTGG - Intronic
954561825 3:51562994-51563016 TGGACAGTTAGGTAATGTCCAGG - Intronic
954579421 3:51695227-51695249 TGAACAGTAAGGCAAGGCCCAGG + Intronic
955500561 3:59578758-59578780 AGGACAGAGAGGCATGGGCAGGG - Intergenic
955793819 3:62614442-62614464 AAGGCAGAGAGGCAAGGACCTGG + Intronic
956462675 3:69486993-69487015 TGTAGAGAAAGGCAAGGTCTAGG - Intronic
957783489 3:84849469-84849491 TGCACAGAGAAGCAGGGCCCTGG + Intergenic
959183208 3:103008123-103008145 TGCACAGAGCAGCAGGGTCCTGG + Intergenic
959840132 3:110965958-110965980 TGGACTGATGGGCAAGCTCCTGG + Intergenic
959939228 3:112062953-112062975 TGGACAGGGAGGTAAGGGGCAGG + Intronic
961564520 3:127754134-127754156 TGGAGAGTGAGGCCAGGGCCTGG - Intronic
962032825 3:131619313-131619335 TGGACAAATAGGGAAGGTCCTGG + Intronic
962404676 3:135090705-135090727 TGGGCAGACAGGCAAGGACAGGG + Intronic
963748789 3:149152775-149152797 TGGACAAGAAGGCAGGGTCCTGG + Intronic
964392172 3:156209193-156209215 TGGAAAGAGGGGCAAGAGCCAGG + Intronic
965568526 3:170147712-170147734 GGGACAGAGAGGGTAGGGCCTGG + Intronic
965980074 3:174679222-174679244 TGCACAGAGAGACAAGGACATGG - Intronic
966872431 3:184299534-184299556 GGAGCAGAGAGGCAAGGTGCCGG - Intronic
967291850 3:187928839-187928861 TGGACAGGCAGGCAACCTCCAGG + Intergenic
967887884 3:194345661-194345683 GGGAGAGTGAGGCAAGGTCCCGG + Intronic
968014679 3:195318981-195319003 TGCACAGAGCAGCAGGGTCCTGG - Intronic
968079681 3:195837257-195837279 TAGACACAGAGGCATGGACCTGG + Intergenic
968761004 4:2442780-2442802 TGGAAGGGGAGCCAAGGTCCAGG + Intronic
968809714 4:2794358-2794380 TGGACAGAGTGGGAAGAACCAGG - Intronic
969117500 4:4880428-4880450 CTGACAGAGAGTCAAAGTCCTGG + Intergenic
969271797 4:6108126-6108148 GTGACAGAGAGGCAGGGGCCTGG + Intronic
969847547 4:9931049-9931071 TGGAGAGAGAGGAAATGGCCTGG + Intronic
970036142 4:11738181-11738203 TGCACAGAGAGGAAGGGCCCTGG - Intergenic
971887627 4:32473589-32473611 TGGACAGAGACGCAAGCAGCTGG - Intergenic
972090382 4:35273865-35273887 TGTAAAGAGAGTCAAGCTCCTGG + Intergenic
972220640 4:36950388-36950410 TGCACAAAGCAGCAAGGTCCTGG + Intergenic
974248859 4:59359676-59359698 TGAACAGAGAAGCTAGGCCCTGG - Intergenic
976850062 4:89534743-89534765 TGGATAAAGAAGCAAGATCCAGG - Intergenic
977678804 4:99776106-99776128 TGGATAAAGAGTCAAGATCCAGG + Intergenic
978282324 4:107034134-107034156 TGGACAGAGAGACAAGACCCGGG - Intronic
979090613 4:116478126-116478148 TGGGTAGAGAGGAATGGTCCCGG - Intergenic
979558768 4:122078989-122079011 GGGGCAGAGAGGACAGGTCCTGG + Intergenic
979805162 4:124961554-124961576 TGCACAGAGCAGCAAGGCCCTGG + Intergenic
980090831 4:128441348-128441370 TGCACAGAGCAGCAAGGCCCTGG + Intergenic
981219342 4:142213382-142213404 TGGAAAGGGAGGCCATGTCCTGG + Intronic
982139931 4:152307598-152307620 GGAAATGAGAGGCAAGGTCCAGG - Intergenic
982389939 4:154852906-154852928 TGCACAAAGAAGCAAGGCCCTGG + Intergenic
982622334 4:157723928-157723950 TGCACAAAGAAGCAAGGCCCTGG - Intergenic
983661084 4:170131390-170131412 TGGACAGAGGGGCCAGCCCCGGG - Intergenic
984256601 4:177397141-177397163 TGGACAGAGAGAAAATGTTCTGG + Intergenic
985334686 4:188879010-188879032 TGGGAAAAGAGGCAAGGTGCAGG + Intergenic
985711297 5:1431387-1431409 TGGACAGTGAGGGACGGGCCTGG + Intronic
986214742 5:5708875-5708897 TGGGCAGAGAGACACGGTCAGGG + Intergenic
986413212 5:7502463-7502485 AGGACAGAGAGGCAGGCTTCAGG + Intronic
986894334 5:12347368-12347390 TGCACAGAGAAGCAGGGCCCAGG - Intergenic
987196893 5:15535974-15535996 TGCACAGAGCAGCAAGGCCCTGG - Intronic
988429666 5:31104835-31104857 CGGAGAGAAAAGCAAGGTCCTGG + Intergenic
989116850 5:37963592-37963614 TGGACACAGAGGGAAAGGCCTGG - Intergenic
989696890 5:44212322-44212344 TGCACAGAGCAGCAAGGGCCTGG - Intergenic
990308333 5:54515532-54515554 TGGAAAGATAGCCAAGGGCCAGG + Intergenic
990523928 5:56606396-56606418 TGGCCAAAGAGGGAAAGTCCTGG - Intergenic
991729756 5:69573933-69573955 AGGACAGAGAGGGAAGGTGTAGG - Intronic
991806188 5:70429073-70429095 AGGACAGAGAGGGAAGGTGTAGG - Intergenic
991865198 5:71053941-71053963 AGGACAGAGAGGGAAGGTGTAGG + Intronic
992762527 5:79963119-79963141 TAGACAGAGAAGCGAGGACCAGG + Intergenic
993337796 5:86682785-86682807 TGGAAAGAAAGGCAAGGACTAGG + Intergenic
993503397 5:88685483-88685505 TGAACAGAGACGCAGGGTTCGGG - Intergenic
993517497 5:88856592-88856614 TGCACAGAGCAGCAAGGTCTTGG - Intronic
996077407 5:119213046-119213068 TGTAAAGTGAGGCAAGCTCCAGG - Intronic
997182332 5:131843151-131843173 TGCACAGAGCAGCAAGGCCCTGG + Intronic
997605422 5:135172580-135172602 TGAACAGAGAGACAAGACCCAGG - Intronic
997745693 5:136298377-136298399 TAGACAGGGAGGCAAGGGCCAGG + Intronic
997860961 5:137415495-137415517 TGGAGGGAGAGGGAAGGACCTGG - Intronic
997915334 5:137918912-137918934 AGGAGACAGAGGCAAGGTCCAGG + Intronic
999095440 5:148973910-148973932 TGGAGAGGCAGGCAGGGTCCAGG - Intronic
1000038446 5:157466833-157466855 TGGACTCAGAAGGAAGGTCCAGG + Intronic
1000239354 5:159395015-159395037 TAGACAGGGAGGCAAGGCTCAGG + Intergenic
1000768363 5:165319309-165319331 TGCACAAAGAAGCAAGGCCCTGG + Intergenic
1001435277 5:171695011-171695033 TGGAAAGAGAAGCAGGGGCCAGG - Intergenic
1001485286 5:172115417-172115439 TGCACAGAAAGCCAAGGGCCAGG + Intronic
1002212615 5:177607813-177607835 TGCACAGAGAAACAGGGTCCTGG - Intronic
1003631986 6:7795483-7795505 TGGACAGAGAGGCAAGGTCCTGG + Intronic
1004377587 6:15104140-15104162 GGGAGAGAGAGCTAAGGTCCTGG + Intergenic
1005172722 6:23006449-23006471 TGGGGAGAGAGGTAAGGTACAGG + Intergenic
1005825896 6:29631776-29631798 AGGACAGAGAGTAAAGGGCCAGG + Intronic
1006342510 6:33454356-33454378 AGGACCGAGAGGCAGGGCCCGGG - Intronic
1007096921 6:39218941-39218963 TCCACAGAGAGGCAGGGACCAGG + Intronic
1007633910 6:43286864-43286886 AGGACAGAGAGGCTAGGCCAGGG - Exonic
1008377774 6:50810757-50810779 TGGAGAGAGAGGCAGGGGCAGGG + Intergenic
1010264978 6:73856080-73856102 TGGTGAGAGAGGGAAGGTCCTGG + Intergenic
1010268224 6:73891553-73891575 TGCACAGAGCAGCAAGGCCCTGG - Intergenic
1011527658 6:88282569-88282591 AGGCCAGAGAGGCAGGGGCCAGG + Intergenic
1013609179 6:111778208-111778230 AGGACAAAGAGGCCAGGCCCGGG + Intronic
1016047667 6:139497165-139497187 TGGCCAGAAAGGCAAAGACCTGG + Intergenic
1016080247 6:139846739-139846761 TGGAGAGAGAGGGAAGGTACTGG - Intergenic
1016152338 6:140757398-140757420 TGGAGAAGAAGGCAAGGTCCAGG + Intergenic
1016440361 6:144076943-144076965 TGGACAGACAGGAAAGGGCAAGG - Intergenic
1017035288 6:150261851-150261873 TGGAGAGAGAGGAAAGGGTCAGG - Intergenic
1017263631 6:152416793-152416815 CGGACAGAGAGGCATGGCTCTGG + Exonic
1019696900 7:2451273-2451295 GGGACAGAGAGCCAAGATCCTGG - Intergenic
1022637251 7:32147954-32147976 TGGGTTGAGAGGCAAGTTCCAGG - Intronic
1023095396 7:36655085-36655107 AAGACAGACAGGCAAGGTACAGG + Intronic
1023849207 7:44140862-44140884 TGGTGTGAGAGGCAAGGTCAGGG + Intronic
1024684955 7:51734773-51734795 TGCACAAAGCAGCAAGGTCCTGG + Intergenic
1026800725 7:73398171-73398193 TGGACAGAGAACTCAGGTCCTGG + Intergenic
1026845813 7:73698684-73698706 TGGGAAGAGGGGCAAGATCCTGG + Intronic
1026967709 7:74450936-74450958 TAGACAAAGAGGCAGGGGCCAGG + Intergenic
1027050278 7:75017466-75017488 TGGAAAGTGAGGCAAGGCACAGG + Intronic
1027532901 7:79357638-79357660 TGGACAGAGATGGAAGGGCATGG - Intronic
1028238487 7:88389729-88389751 TGAACTGAGATTCAAGGTCCAGG - Intergenic
1029382759 7:100224187-100224209 TGGAAAGTGAGGCAAGGCACAGG - Intronic
1029467564 7:100735957-100735979 TGGACAGAATGACAAGGTCCGGG - Intronic
1029668891 7:102014953-102014975 TGGACACGGAGGCAGGGTCTTGG - Intronic
1031790390 7:126094367-126094389 TGCACAGGGCAGCAAGGTCCTGG + Intergenic
1032558192 7:132859892-132859914 TGGAATCAGAGGCAAGGTCTGGG - Intronic
1032698568 7:134358882-134358904 TGGATAAAGAGGCAAGGACGGGG + Intergenic
1035443410 7:158922596-158922618 TGGACAGAGCGTGAAGGTGCAGG + Intronic
1036016578 8:4791674-4791696 TGGAGAGAGAGGCCAGGATCTGG + Intronic
1036222016 8:6929135-6929157 GGGAGACAGAGGCAAGGCCCAGG - Intergenic
1037611560 8:20480506-20480528 TGCACACAGAGGCAGGCTCCTGG + Intergenic
1037674115 8:21039634-21039656 AGGGCTGAGAGGCCAGGTCCGGG - Intergenic
1038459242 8:27702568-27702590 AGGACAGAGACCCAAGGTCCAGG - Intergenic
1038686627 8:29724830-29724852 TGGAGAGGGTGGGAAGGTCCTGG - Intergenic
1039774810 8:40724848-40724870 TGGATAGGGAGGCAGGATCCAGG + Intronic
1039811604 8:41054122-41054144 AGGACAGAGAGGGAAGCTCAAGG - Intergenic
1040904126 8:52448020-52448042 TGGACATAGAGGTGAGCTCCAGG - Intronic
1040945935 8:52883935-52883957 TGCACAGAGCAGCAGGGTCCTGG + Intergenic
1041148176 8:54902080-54902102 AGGACAGATAGGCAAGGGCCAGG + Intergenic
1041894435 8:62907573-62907595 TGTACAAAGCAGCAAGGTCCTGG - Intronic
1042219631 8:66460632-66460654 TGAACAGAAAGGCGAGGGCCTGG - Intronic
1042661229 8:71156659-71156681 TTGACAGAGAGGGAAGGGACAGG - Intergenic
1044114845 8:88322859-88322881 TGAACAGAGAGGCATAGTCAAGG + Intronic
1044303903 8:90616432-90616454 TGCACAAAGCAGCAAGGTCCTGG - Intergenic
1044494910 8:92865495-92865517 AGGTCAGGGAGGGAAGGTCCAGG + Intergenic
1046901894 8:119532814-119532836 TGGAGAGAAAGTCAAGGACCAGG + Intergenic
1049158993 8:141085349-141085371 TGGACAGGGCGGCAAGGACCCGG + Intergenic
1049169099 8:141147394-141147416 TGGACAGTGAGACAGGGTCCAGG - Intronic
1049376670 8:142292620-142292642 TGGAATGAGAAGCAAGGTCAAGG + Intronic
1049413845 8:142486169-142486191 TGGGCAGAGAAGCAGGGTCCTGG - Intronic
1049599264 8:143499419-143499441 AGGACAGAGGGGCAAGACCCAGG - Intronic
1049987923 9:969891-969913 TGGAAAGTCAGGCAAGGCCCAGG + Intergenic
1050951276 9:11598778-11598800 TGGGAAGAGAGGTGAGGTCCAGG + Intergenic
1050974186 9:11915779-11915801 TGCACAGTGTGGCAAGGCCCTGG + Intergenic
1051331702 9:16030774-16030796 TGGTAGGAGAGGCAAGCTCCTGG - Intronic
1051358152 9:16258592-16258614 TGAAAAGAGAGGCAAGGAGCGGG + Intronic
1052702211 9:31950883-31950905 TGTTCAGAGTGGCAGGGTCCTGG + Intergenic
1052990791 9:34518397-34518419 TGGCCAGGGAGGCAAGGGCTGGG + Intronic
1053135941 9:35650313-35650335 GGGGCACAGAGGCCAGGTCCTGG - Intronic
1053471414 9:38348270-38348292 TGAACAGAGAAGGAAGATCCTGG - Intergenic
1054897383 9:70329049-70329071 TGCACAGAGCGGCAGGGCCCTGG + Intronic
1056286364 9:85091483-85091505 TGCACAGTGATGAAAGGTCCAGG + Intergenic
1056318001 9:85409994-85410016 TGAACAGATAGGCCTGGTCCAGG + Intergenic
1056579958 9:87883418-87883440 TGGACTCAGTGGCAAGGACCGGG + Intronic
1056712586 9:89002617-89002639 TTCACAGAGAGGGAAGGTCGTGG + Exonic
1057095265 9:92301620-92301642 TGGTCAGAGCTGCAGGGTCCTGG + Exonic
1057438391 9:95063345-95063367 AGGTCAGAAAGGCAAGGTCCAGG - Intronic
1057592615 9:96385347-96385369 TTGACAGCGAGGTAAGGTCCTGG - Intergenic
1058330602 9:103755553-103755575 TTGAAAGAGAGACAAGATCCAGG + Intergenic
1058619109 9:106864189-106864211 TGAACAGAGAGGCGAGGAGCGGG + Intronic
1058811575 9:108644624-108644646 TGGAGAGAAGGGCAAGGACCAGG - Intergenic
1059283277 9:113152283-113152305 TGGTCAGATAGGCAAGGGGCAGG - Intronic
1059798022 9:117720799-117720821 AAGACGGAGGGGCAAGGTCCTGG - Intergenic
1060295292 9:122339126-122339148 TGGACAGGGAGGCAAGGGAAGGG - Intergenic
1060807114 9:126584773-126584795 TGGCCAGAGAGGAAGGGTACTGG + Intergenic
1061134951 9:128728507-128728529 GGGAGAGAGAGGCCAGGTCCAGG + Intergenic
1061716612 9:132522198-132522220 TGCACATAGAGGCCAAGTCCAGG - Intronic
1062351856 9:136143359-136143381 GGGAAACTGAGGCAAGGTCCTGG + Intergenic
1062541597 9:137044054-137044076 TGGGCAGAGAGGAAGAGTCCTGG - Intronic
1062670042 9:137703149-137703171 TGCACAGAGCAGCAAGGCCCTGG + Intronic
1203517320 Un_GL000213v1:14617-14639 TGGACACAGAGGGGAGGTCAAGG - Intergenic
1187002811 X:15199910-15199932 TGCACAAAGAAGCAAGGCCCTGG + Intergenic
1187598378 X:20800037-20800059 TGCACAAAGAAGCAAGGCCCTGG - Intergenic
1188747708 X:33867047-33867069 TGGACAGAAAGGCAGGGACAAGG - Intergenic
1188933102 X:36139507-36139529 TGGACCGAGAGGAAAGGAACTGG + Intronic
1189011327 X:37048571-37048593 TGCACAGAGAAGCAGGGCCCTGG - Intergenic
1190627516 X:52351053-52351075 TGAAAAGATAGGCAATGTCCAGG + Intergenic
1190873248 X:54442331-54442353 GGGAAAAAGAGGCAAGTTCCTGG + Intronic
1192051092 X:67724565-67724587 TGGACAGAGAGGAGAGGACAAGG + Exonic
1194302996 X:92210026-92210048 TGCACAGAGCAGCAGGGTCCTGG + Intronic
1196458770 X:115908512-115908534 TGAACAGAGAGGCAAAGTCCAGG + Intergenic
1196817888 X:119679402-119679424 TGGACAGAGAGACTAGGAGCAGG + Intronic
1197134825 X:123049014-123049036 GGGACAGAGATGCAAGAACCAGG + Intergenic
1198303175 X:135351026-135351048 TGGAGAGAGAAGCAGGGTCCTGG + Intronic
1198485340 X:137081579-137081601 AGGAGGGAGAGGCAAGGTCTTGG + Intergenic
1198699972 X:139385971-139385993 TGGACAGAGCAGAAAGGTACTGG + Intergenic
1199117427 X:144008845-144008867 TGCACAGAGCAGCAGGGTCCTGG + Intergenic
1199650503 X:149943233-149943255 AGCACAGAGAGGCAAGGTGATGG - Intergenic
1200070064 X:153524803-153524825 TGGACAGAGAAGCAAGCTTTAGG - Intronic
1201227002 Y:11828007-11828029 TGGCTGGAGAGTCAAGGTCCAGG - Intergenic