ID: 1003631987

View in Genome Browser
Species Human (GRCh38)
Location 6:7795492-7795514
Sequence AGGCAAGGTCCTGGCTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003631975_1003631987 25 Left 1003631975 6:7795444-7795466 CCTGTTAGTTCAGGGATCCCCAA 0: 1
1: 0
2: 1
3: 12
4: 152
Right 1003631987 6:7795492-7795514 AGGCAAGGTCCTGGCTACAAAGG No data
1003631981_1003631987 7 Left 1003631981 6:7795462-7795484 CCCAAGGCAGAGGGATGTGGCTG 0: 1
1: 0
2: 3
3: 31
4: 333
Right 1003631987 6:7795492-7795514 AGGCAAGGTCCTGGCTACAAAGG No data
1003631982_1003631987 6 Left 1003631982 6:7795463-7795485 CCAAGGCAGAGGGATGTGGCTGG 0: 1
1: 1
2: 4
3: 51
4: 396
Right 1003631987 6:7795492-7795514 AGGCAAGGTCCTGGCTACAAAGG No data
1003631980_1003631987 8 Left 1003631980 6:7795461-7795483 CCCCAAGGCAGAGGGATGTGGCT 0: 1
1: 0
2: 7
3: 18
4: 215
Right 1003631987 6:7795492-7795514 AGGCAAGGTCCTGGCTACAAAGG No data
1003631974_1003631987 26 Left 1003631974 6:7795443-7795465 CCCTGTTAGTTCAGGGATCCCCA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1003631987 6:7795492-7795514 AGGCAAGGTCCTGGCTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003631987 Original CRISPR AGGCAAGGTCCTGGCTACAA AGG Intronic
No off target data available for this crispr