ID: 1003635414

View in Genome Browser
Species Human (GRCh38)
Location 6:7827241-7827263
Sequence GTTTTCCCCTGAAGCGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003635414_1003635417 19 Left 1003635414 6:7827241-7827263 CCTGCTGCGCTTCAGGGGAAAAC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1003635417 6:7827283-7827305 TTAGCTTGGACTGAATCCGGAGG No data
1003635414_1003635415 5 Left 1003635414 6:7827241-7827263 CCTGCTGCGCTTCAGGGGAAAAC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1003635415 6:7827269-7827291 GTTAAGTGAGCAGTTTAGCTTGG 0: 1
1: 0
2: 0
3: 8
4: 113
1003635414_1003635416 16 Left 1003635414 6:7827241-7827263 CCTGCTGCGCTTCAGGGGAAAAC 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1003635416 6:7827280-7827302 AGTTTAGCTTGGACTGAATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003635414 Original CRISPR GTTTTCCCCTGAAGCGCAGC AGG (reversed) Intronic
900918831 1:5658133-5658155 AATTTCCCCTGAAGGGCAGAGGG - Intergenic
905654989 1:39680832-39680854 GTTTTCACCTGCAGAGAAGCAGG + Exonic
905911031 1:41654803-41654825 GTTTCTCCCTGCAGGGCAGCTGG - Intronic
910610351 1:89134467-89134489 GTTGGCCCCTGCAGCACAGCAGG + Intronic
915247618 1:154567805-154567827 GTATTCCCTGGAAGAGCAGCCGG + Exonic
917018879 1:170564488-170564510 GTTTTCCCCTGAAAGGAAACAGG + Intergenic
1066064123 10:31750107-31750129 CCTCTCCCCTGAAGCCCAGCCGG - Intergenic
1071957626 10:90777063-90777085 GTTTTCCTCTGAGGGTCAGCAGG + Intronic
1077453068 11:2662550-2662572 GCCTTCCCCTGAGGCACAGCTGG + Intronic
1078479190 11:11661305-11661327 GTTTCCTCCTGAAGAGCAGGAGG - Intergenic
1083868971 11:65475364-65475386 TTATTACCCTGCAGCGCAGCAGG - Intergenic
1084559194 11:69893171-69893193 ATTATCCCCTGAAGGGAAGCAGG + Intergenic
1086807188 11:91258579-91258601 TTTTTCCTCTGAATCACAGCTGG + Intergenic
1090674726 11:128980583-128980605 AATTTCCCCTGAAGTGCAGCAGG + Exonic
1092369229 12:7902847-7902869 GTTTTCCCCTGTCGCCCAGACGG + Intergenic
1093898140 12:24599314-24599336 GATTTTCTCTGAAGCTCAGCAGG + Intergenic
1096222273 12:49838454-49838476 GTTTTGCCCTGAAGAGCAGAAGG + Exonic
1105015790 12:132786245-132786267 GTTGTCCCCTAAAGCCTAGCGGG - Intronic
1105622131 13:22078507-22078529 GTATTGCCCTGAGGCCCAGCTGG + Intergenic
1111519905 13:89386996-89387018 GATTTTCCCTGAAGTCCAGCAGG + Intergenic
1113245511 13:108390597-108390619 CTTCTCCCCAGAAGCCCAGCTGG + Intergenic
1119272739 14:73323985-73324007 CTTCTCCCCTGAAGAGCAGGAGG + Intronic
1120131982 14:80818648-80818670 CTTTCTCCCTGAAGCCCAGCAGG + Intronic
1120408581 14:84121033-84121055 TTTTTCCCCTGAAGCCCACAAGG + Intergenic
1122869982 14:104634097-104634119 GTTTTCACCTGATGGGCAGATGG - Intergenic
1124136633 15:27041375-27041397 GTTTTCCCATGTTGCCCAGCTGG + Intronic
1129340590 15:74883298-74883320 GTTTTGCCATGTAGCCCAGCTGG - Intergenic
1132592232 16:731070-731092 GTCATCCCCTGAAGCCCAGCAGG - Intronic
1132724333 16:1332377-1332399 GTTTTCACCCGAAGGGCACCTGG - Intergenic
1134036437 16:11034707-11034729 GTGCTCCCGTGAAGTGCAGCAGG + Intronic
1141461973 16:84183188-84183210 GTTCACCCCTGAAGGACAGCAGG + Intronic
1143541520 17:7572360-7572382 GTTTTCCCCTGTAGCAGAGATGG - Exonic
1144627961 17:16854743-16854765 GTTTACCACTGAGGGGCAGCTGG + Intergenic
1145159553 17:20565324-20565346 GTTTACCACTGAGGGGCAGCTGG + Intergenic
1146516243 17:33491808-33491830 CTTTCCCTCTTAAGCGCAGCAGG - Intronic
1147357195 17:39907318-39907340 GTTTTCCCCTTGATCCCAGCAGG - Intronic
1148683676 17:49488661-49488683 GTTTTCCCTTGAAGGGGAGGCGG + Intergenic
1150893307 17:69179765-69179787 GTTTTCCCCTCAATGGTAGCAGG - Intronic
1151728516 17:75897773-75897795 CATTTCCCCTGAAGCTGAGCAGG + Intergenic
1160021541 18:75185366-75185388 GGCTTACCCTGAAGGGCAGCGGG + Intergenic
929266971 2:39929139-39929161 CTTTTCCCCAGAAGCACAGAAGG + Intergenic
929575575 2:43049794-43049816 GTGTGCCCCTAAAGCGCATCTGG - Intergenic
929956252 2:46460783-46460805 ATCTTCCCCTGAAGCTGAGCTGG - Intronic
931078375 2:58741719-58741741 GTTTTGCCCTGTTGCCCAGCTGG - Intergenic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
936033443 2:109090168-109090190 GTTTTGTCCTGAAGGGCAACAGG + Intergenic
944130391 2:196341316-196341338 CTTTTCCCCTGAAGTTCAGTTGG + Intronic
945067212 2:205957315-205957337 GGGGTCCCCTGAAGGGCAGCAGG + Intergenic
946524908 2:220507859-220507881 GTTTTCTCCTGAATGACAGCTGG + Intergenic
946981276 2:225218654-225218676 GTTTTCCACTTAACCACAGCTGG + Intergenic
947732368 2:232438522-232438544 GGCTTCCTCTGAAGCGCAGATGG + Intergenic
1169025330 20:2365897-2365919 GTTCTACTCTGAAGCCCAGCAGG - Intergenic
1170604247 20:17863850-17863872 GTTTCTTCCTGGAGCGCAGCTGG - Intergenic
1173860028 20:46277320-46277342 GTTTACCTCTGGAGAGCAGCGGG + Intronic
1178703443 21:34853276-34853298 GTTTTCCCCGGCAGGGCTGCAGG - Intronic
1178874610 21:36404125-36404147 GTTTTGCCCTGTTGCCCAGCTGG + Intronic
1179632609 21:42688158-42688180 GTGTTCCCCTGCAGAGGAGCTGG + Intronic
1180215049 21:46318403-46318425 GCCTTCCCATGAAGCCCAGCTGG - Intronic
1182501872 22:30753779-30753801 GTTTCCCCCTGAAGGGTTGCAGG - Intronic
950331784 3:12161623-12161645 GTTCAACCCTGAAGCACAGCAGG - Intronic
950868361 3:16207817-16207839 GTTTTCCCCTGAATCTCAAAGGG + Intronic
953068710 3:39498829-39498851 ATTTTCCCCTGAAGTGCTGGGGG + Intronic
958494247 3:94822675-94822697 ATTTTCCCCAGAAGTCCAGCTGG - Intergenic
958693625 3:97500355-97500377 GTCTTCCCCAGAAGCTGAGCAGG - Intronic
964727133 3:159825298-159825320 ATTTTGCCCTCAAGTGCAGCTGG + Intronic
966111337 3:176405476-176405498 GTTTTGCCATGTAGCCCAGCTGG + Intergenic
973056402 4:45664811-45664833 GTTTTCCTCTGAAACACAGGTGG - Intergenic
974589097 4:63920077-63920099 GTTTTTCACTGTAGCTCAGCTGG + Intergenic
990954837 5:61331672-61331694 CTTTTCCCCCGAAGGGCAGGGGG + Intergenic
991970439 5:72135800-72135822 GTTTTGCCTTGAAAGGCAGCTGG + Intronic
996257593 5:121425123-121425145 GTCTTCCCCTCAGGGGCAGCTGG - Intergenic
997613030 5:135228420-135228442 TTTTTTTCCTGAAGAGCAGCTGG - Intronic
999481950 5:151956688-151956710 GTCTTCCCCAGAAGTGAAGCAGG - Intergenic
1002278895 5:178119652-178119674 CTTCTCCCCTGAAGAGCTGCGGG + Exonic
1002916151 6:1529420-1529442 GTTTTCCCCTCTAGCGTGGCAGG + Intergenic
1002952877 6:1832841-1832863 CTTTTCCGCTGAAGCTCATCAGG - Intronic
1002961829 6:1922753-1922775 GTCTTCCCCTGACGTCCAGCCGG - Intronic
1003635414 6:7827241-7827263 GTTTTCCCCTGAAGCGCAGCAGG - Intronic
1011670710 6:89680529-89680551 GTTTTCCCCAGTGGCGCAGGAGG - Intronic
1024120057 7:46227548-46227570 GTGTTCCCCTGGAGAGAAGCAGG - Intergenic
1024321103 7:48070543-48070565 ATTTTCCCTTGAAGAGCTGCAGG - Intergenic
1026947449 7:74325489-74325511 GTTTTTCCCTGAACGGCAGCTGG - Intronic
1029625941 7:101720289-101720311 GGTTTCCTCTGACTCGCAGCTGG + Intergenic
1030447257 7:109662480-109662502 TTTTTCCCCTCAACCACAGCTGG + Intergenic
1031982350 7:128135991-128136013 CTTTGCCTCTGAAGCACAGCAGG + Intergenic
1031982462 7:128136510-128136532 CTTTGCCTCTGAAGCACAGCAGG + Intergenic
1037704660 8:21309122-21309144 GTATTCCCCTCAGGGGCAGCAGG - Intergenic
1038482505 8:27911377-27911399 GTTTTCTCTTGAAAAGCAGCAGG - Intronic
1039162586 8:34639342-34639364 ATCTTCCCCTGAAGTCCAGCCGG - Intergenic
1041704623 8:60832762-60832784 GTTTTCCCCCAAAACACAGCTGG + Intronic
1042040922 8:64587447-64587469 GTTGTCCCCTGTATGGCAGCAGG + Intergenic
1042229775 8:66544040-66544062 GTTTTGCTGTGAAGAGCAGCAGG + Intergenic
1044889033 8:96812813-96812835 GTTTTTCCCTCAAGCTGAGCTGG + Intronic
1049194778 8:141308889-141308911 GTTTTCTCCTGCAGCGGAGGAGG - Intergenic
1053351242 9:37414669-37414691 ATTTTCCGATGACGCGCAGCAGG - Intergenic
1060938317 9:127528563-127528585 GTTTCCCCTTGAAGAGCAGCAGG - Intronic
1188587281 X:31793061-31793083 ATCTTCCCCTGAAGTCCAGCCGG + Intronic
1191026031 X:55914355-55914377 GTCTTGCCCTGGAGCTCAGCTGG + Intergenic
1192590459 X:72355345-72355367 ATTTTCCCTTGAAGGTCAGCTGG - Intronic
1198071684 X:133154638-133154660 GTTTTCCCATGTTGCCCAGCTGG + Intergenic
1199334319 X:146600564-146600586 GTATTCCCCTGAGGCTGAGCTGG + Intergenic
1199607843 X:149590862-149590884 GTTTTCCTGTGAATCTCAGCTGG - Intergenic
1199631280 X:149778506-149778528 GTTTTCCTGTGAATCTCAGCTGG + Intergenic
1199675396 X:150184736-150184758 GATATCCCCAGAATCGCAGCAGG + Intergenic