ID: 1003635613

View in Genome Browser
Species Human (GRCh38)
Location 6:7828941-7828963
Sequence CTGTGCCAAGCCCTGGGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 15, 3: 55, 4: 464}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003635613_1003635619 14 Left 1003635613 6:7828941-7828963 CCGTGTCCCAGGGCTTGGCACAG 0: 1
1: 0
2: 15
3: 55
4: 464
Right 1003635619 6:7828978-7829000 GAATAATAGGTCATCTGATGCGG 0: 1
1: 0
2: 0
3: 8
4: 105
1003635613_1003635620 28 Left 1003635613 6:7828941-7828963 CCGTGTCCCAGGGCTTGGCACAG 0: 1
1: 0
2: 15
3: 55
4: 464
Right 1003635620 6:7828992-7829014 CTGATGCGGTATAATTTAATAGG No data
1003635613_1003635617 1 Left 1003635613 6:7828941-7828963 CCGTGTCCCAGGGCTTGGCACAG 0: 1
1: 0
2: 15
3: 55
4: 464
Right 1003635617 6:7828965-7828987 GGTGCTGTGCCGCGAATAATAGG 0: 1
1: 0
2: 1
3: 2
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003635613 Original CRISPR CTGTGCCAAGCCCTGGGACA CGG (reversed) Intronic
900075509 1:813318-813340 CTCTGACAAGCCCAAGGACAGGG + Intergenic
900594032 1:3472363-3472385 CTGGACCAAGGCCTGGGTCATGG + Intronic
900608123 1:3532836-3532858 CTGTGCCAGGCCCTGGGTTCTGG + Intronic
900955802 1:5885597-5885619 CTGTGCCATGGCTGGGGACATGG - Intronic
901000488 1:6146622-6146644 CTGTGCTAAGGCCCGGGACCTGG - Intronic
901225064 1:7608536-7608558 CTGTCCCCAGCCCAGGGAAAGGG + Intronic
901863485 1:12089270-12089292 ATGTGCCAAGCCCTGGGGTCAGG - Intronic
901924180 1:12555459-12555481 TTGTGCCAAGCCTTGGGGCCTGG + Intergenic
902437504 1:16408055-16408077 CTGTGCCCAGCCCTGGTAGAGGG + Intronic
902757755 1:18560344-18560366 CTGTGCCTGGCCCTGGGACAAGG - Intergenic
902808846 1:18877106-18877128 CTGGGTCATGCCCTGGGTCAGGG + Intronic
902819126 1:18932880-18932902 TTGTGCCAGGCACTGGGATATGG - Intronic
903060244 1:20664117-20664139 CTGTGCCACCCCATGGGGCAGGG + Exonic
903451892 1:23459296-23459318 GTTTGCAAAGTCCTGGGACATGG + Intronic
903535327 1:24062979-24063001 CTCTGCTAACCCCTGGGACCAGG + Intronic
903797428 1:25940313-25940335 CAGTGGCAAGGCCTGGGACTGGG + Intergenic
903875460 1:26470717-26470739 CTCTACCAATCCCTGGCACAGGG + Exonic
904003921 1:27353518-27353540 CTGGGACAGGCCCTGGGAGATGG + Intronic
904296213 1:29521344-29521366 CTGTGCCAAGCCCTGGGAGCTGG + Intergenic
904343987 1:29856276-29856298 CTGTGCCCAGCTCTGAGCCAGGG + Intergenic
904410118 1:30320102-30320124 CTGTGCCAAGGCCTGGGAGCCGG - Intergenic
904433541 1:30479767-30479789 ATGCACCAAGCCCAGGGACACGG - Intergenic
904584679 1:31573585-31573607 CTGTCCCAGGCCCTTGGATAAGG + Intergenic
904945999 1:34199220-34199242 GTGTGCCCAGACCTGGGACGAGG + Intronic
905705755 1:40055944-40055966 CTGTGCCAAGCACTTCTACATGG + Intronic
906071891 1:43022941-43022963 ATGTGCCAAGCCCTGTGATGGGG + Intergenic
906247590 1:44287986-44288008 CTCTGGCTAGCCCTGGGAGAGGG + Intronic
906726602 1:48048895-48048917 TTGGACCAAGCCCTTGGACACGG - Intergenic
906962606 1:50427496-50427518 CTATGCCACGACCTGGGACCGGG + Intergenic
907246812 1:53114082-53114104 CTGTGCCAGGCCCTGGACCAGGG - Intronic
907249755 1:53130343-53130365 CCATGCCAAGCCCTGGAACCAGG - Intronic
907259687 1:53208248-53208270 CTGTGCCAGGCCTTGGTCCAGGG - Intronic
907337865 1:53712175-53712197 CTGTGCAAAGGCCTGGTAGAAGG - Intronic
907362420 1:53929325-53929347 CTGTAACTAGCCCTGGCACAGGG - Intronic
908356471 1:63328600-63328622 CTGTTCTAAGCACTGGTACACGG + Intergenic
908459652 1:64337003-64337025 CAGTGAGAAGCCCTGGGGCAGGG - Intergenic
908540362 1:65116443-65116465 CTAAGCTAGGCCCTGGGACAAGG + Intergenic
908749296 1:67404203-67404225 CTTTTCAAAGACCTGGGACAGGG + Intergenic
909248880 1:73327010-73327032 GAGTGACAAGCCCTGGGACAGGG - Intergenic
909884571 1:80924840-80924862 CTGTGCAAATCTCTGGAACATGG - Intergenic
910552043 1:88486320-88486342 CTGTGTCAAGACCTGGTACCAGG - Intergenic
912084477 1:105981935-105981957 CTCTGTGCAGCCCTGGGACATGG + Intergenic
912451171 1:109768610-109768632 CTTTCCCCAGCCCTGGCACAGGG + Intronic
912485450 1:110023919-110023941 CTGTGCCAAGCACCGGGCCTGGG + Intergenic
912860185 1:113207204-113207226 CTGTGCCAATCACTGTGACAAGG - Intergenic
915308216 1:154993305-154993327 TTGTGCCAACCACTGGGAAAAGG + Intergenic
915974420 1:160375591-160375613 CTGTGCCCAGACTTGGGAAAGGG - Intergenic
917894530 1:179474936-179474958 CTCTGTGAAGCCTTGGGACATGG + Intronic
920555076 1:206898773-206898795 CTGTGCCCCTCCCTGGGACCAGG + Intronic
920556722 1:206909622-206909644 CTGTGGGAAGCCCTGGCACCTGG + Intronic
920920801 1:210295810-210295832 CTGTGCCAACCTCAGTGACATGG - Intergenic
920987874 1:210907599-210907621 CTGTGCTCAGCCCTGGCACTAGG - Intronic
921172857 1:212564784-212564806 CTGAGCCAAGCCCTGTAACCTGG + Intergenic
922271353 1:224038192-224038214 CTCTGACAAGCCCAAGGACAGGG + Intergenic
924605194 1:245528233-245528255 CTGTGCGGAGCCCTGGGTCTCGG - Intronic
1063310199 10:4945134-4945156 CTCTGTGAAGCCTTGGGACACGG + Intronic
1064243322 10:13650038-13650060 CTGAGCATAGCCCTGGGAAAGGG - Intronic
1064328386 10:14372129-14372151 CTGTACCAGGCCCTGGGTCATGG - Intronic
1065486559 10:26241473-26241495 CTGTGCCAAGCCTGGGATCAGGG - Intronic
1065860348 10:29867362-29867384 TTGTGCCTCCCCCTGGGACAAGG + Intergenic
1065903183 10:30226234-30226256 CTGTGCCAAGCCCACAGTCAAGG - Intergenic
1068514168 10:58005388-58005410 CTGTGTCAGGCTCTGGGACTTGG - Intergenic
1069994860 10:72335930-72335952 CTCTGCAAAGCAATGGGACAGGG + Exonic
1070637889 10:78143815-78143837 CTGTGCCCAGCCCAAGGAAATGG - Intergenic
1070749267 10:78954384-78954406 CTGTGCCAGGCCCTGGGAGCAGG + Intergenic
1070756272 10:78995274-78995296 CTGTGCCAGGCACTGGGCAAGGG - Intergenic
1072301795 10:94068957-94068979 CTGTGCTAAGCACAGGGGCAGGG - Intronic
1072668078 10:97408994-97409016 CTGTGCCAGGCACTGGGCTAAGG - Intronic
1074434952 10:113426122-113426144 ATGTGCCAAGCCCTGTGATCAGG - Intergenic
1074703170 10:116109959-116109981 CTGTGCCAGACACTGGGATATGG - Intronic
1074703220 10:116110271-116110293 CTGTGCCAGGCACTGGGCTATGG + Intronic
1074901346 10:117818701-117818723 CTGTGCCAAGCCATGGGCCCAGG - Intergenic
1075273948 10:121076909-121076931 CTGTGCCAAGGCCCGTCACAAGG - Intergenic
1075302557 10:121338362-121338384 TTGAGCCAAGCCCCGTGACAGGG - Intergenic
1075479725 10:122769505-122769527 CTGTGCCAAGCACTGGGGATGGG + Intergenic
1075933928 10:126323596-126323618 CTGTGCCAAGCACTGCACCAAGG + Intronic
1076687643 10:132205217-132205239 CTGGGCCCAGCCTGGGGACAGGG + Exonic
1076888178 10:133272021-133272043 CTGTGCCAAGTCCTGGGCCCTGG - Intronic
1077153719 11:1082409-1082431 CTGTGCCCAGCCCTGGCCCCGGG - Intergenic
1077315391 11:1917390-1917412 CTGAGCCAAGCCCAGGGAGTGGG - Intergenic
1077519986 11:3027219-3027241 CTGTGCCAAGCCGAGAGGCATGG - Intronic
1077548491 11:3188276-3188298 CCGTGCCCAGCCCTGTGAGAGGG - Intergenic
1078535595 11:12170890-12170912 CTGTGCCAAGCCCTGTGCTGGGG - Intronic
1078660596 11:13282541-13282563 CTGGGCCAAGGGCTGGTACAGGG - Intronic
1079005021 11:16785453-16785475 GTGTGCCAGGCCCTGTGCCAGGG + Intronic
1079317331 11:19419939-19419961 ATGAGCAAAGCCCTGGGTCAGGG + Intronic
1081488364 11:43548265-43548287 GGGTACCAAGGCCTGGGACAGGG - Intergenic
1081644072 11:44777855-44777877 GTATGCCAAGCCCTGGTTCAGGG + Intronic
1081702586 11:45161467-45161489 CTGTGCCAAGCAAGGGGTCAGGG - Intronic
1081703621 11:45167453-45167475 CTGGGCCAACCCATGGGACTCGG - Intronic
1082820198 11:57539512-57539534 CTGTGCCCAGCCCTGTGCCAGGG - Intergenic
1083257940 11:61508252-61508274 CGGAGCCAAGCCCTGGGGCCCGG + Intergenic
1083614977 11:64021776-64021798 GTGTGCCAGGCGCTGGGACACGG + Intronic
1083641031 11:64145448-64145470 GTGTGCCAGGCCCTGGGCCCAGG + Intronic
1083817981 11:65148120-65148142 CTGTGGCAGGCCCTGGGTCTGGG - Intergenic
1083893421 11:65608172-65608194 CTGGGCCAAGTCCAGGGACAGGG - Intronic
1084217975 11:67661562-67661584 CTGTGCCCAGCCCTGAGAGCAGG - Intergenic
1084423817 11:69073507-69073529 CTGAGCCAGACCCTGGAACAGGG + Intronic
1084548452 11:69826160-69826182 CTGGGCCAAGCCCTGGGGAGGGG - Intergenic
1084617791 11:70247887-70247909 CAGTGCCAAGCCAGAGGACAGGG + Intergenic
1085175948 11:74488363-74488385 CTGTGCCAGGCCCTGAGCCAGGG + Intergenic
1085479587 11:76810192-76810214 GTGTGCCAGGCCCTGTGACGGGG - Intergenic
1085732285 11:79010235-79010257 ATGTGCCAAGCACTAGGACATGG + Intronic
1086228622 11:84542099-84542121 CTGTGCCAACTCCTGCTACAAGG - Intronic
1087831748 11:102826362-102826384 CTGTGCACAGCCTTGGGACTTGG - Intergenic
1089681099 11:120119405-120119427 CTGTGCAAAGCCCTCCCACAGGG + Intronic
1089763294 11:120744515-120744537 CTATGCCAGGCCCTGGGCAAAGG + Intronic
1090858357 11:130631327-130631349 TTGTGCAAAGCCCAGGCACAGGG + Intergenic
1091128421 11:133123113-133123135 CTGTGACAACCCCAAGGACATGG + Intronic
1091180670 11:133601574-133601596 CTGTGCCCAGCACTGTGCCAGGG + Intergenic
1091252183 11:134153495-134153517 CACTGCCAGGCCCTGGGACAGGG - Intronic
1092236944 12:6816296-6816318 CTGAGGCAAGGCCTGGGGCAGGG - Exonic
1094540803 12:31361992-31362014 CTCTGCCCAACCCTGGGAAACGG + Intergenic
1095397744 12:41779901-41779923 CTGTGCCAGGCACTGCGTCACGG - Intergenic
1096217494 12:49806093-49806115 ATGTGCCAGGCACTGGGACACGG + Intronic
1096634902 12:52952005-52952027 ATGTGCCAAGTACTGGGATAAGG - Intronic
1096941600 12:55352394-55352416 CTGTGCCAACTCCTGGGGGAGGG + Intergenic
1098389856 12:69958025-69958047 CTGAGCCAAGCCCTGTGACTAGG - Intronic
1100462497 12:94815096-94815118 ATGTGCCAAGCACTGGGATATGG + Intergenic
1100819850 12:98420716-98420738 CTGTGCCAATCATTGGCACACGG + Intergenic
1101984652 12:109436241-109436263 CTGTTCCTTGCCCTGGGAAAAGG + Intronic
1102259318 12:111434810-111434832 GTGTGTCAAGGCCTGTGACATGG + Intronic
1103275719 12:119710302-119710324 CTGCTCCAATTCCTGGGACATGG + Exonic
1103709609 12:122902221-122902243 CTGTGGCTACCTCTGGGACATGG - Intergenic
1104115920 12:125748899-125748921 CTCTGTGCAGCCCTGGGACATGG + Intergenic
1104415895 12:128596426-128596448 CTGTACCAAGACCTGCGAAAGGG - Intronic
1104972318 12:132537448-132537470 CACTGCGACGCCCTGGGACACGG - Intronic
1105607033 13:21934475-21934497 CCGTGCCAGGCCCTGAGGCAAGG - Intergenic
1106920745 13:34560859-34560881 CTGTGCCAGGCACAGGGATATGG + Intergenic
1107373558 13:39777951-39777973 CTGTGCAAAGCCCAGTGCCATGG + Intronic
1108768362 13:53663381-53663403 CTTTGCGCAGCCTTGGGACATGG + Intergenic
1109010004 13:56928362-56928384 CAGTGCCTAGCCCTGGCAGAAGG - Intergenic
1109074752 13:57821056-57821078 CTGTGGCAGGCCCTGGGCCTGGG - Intergenic
1109130199 13:58575027-58575049 CTGTGTGCAGCCTTGGGACATGG - Intergenic
1110372509 13:74755791-74755813 CAATGGCAAGCACTGGGACATGG + Intergenic
1110601503 13:77379955-77379977 CTGTGCCAAGCCCTTTCACCAGG + Intergenic
1111686812 13:91512527-91512549 CTTTGCCAAGTGCAGGGACATGG - Intronic
1111688261 13:91527925-91527947 CTCTGCACAGCCTTGGGACATGG - Intronic
1113864150 13:113510047-113510069 CTGTGCCAGGCACTGTCACAGGG - Intronic
1114744467 14:25132871-25132893 CTGAGCTCAGCCCTGGGAGATGG + Intergenic
1115133653 14:30083666-30083688 CTGGGCCATGACCTGGCACAGGG + Intronic
1115450710 14:33544053-33544075 CTGTGCCAGACCCTGGGAGAAGG - Intronic
1116069821 14:40029731-40029753 CTGTGATAATGCCTGGGACATGG - Intergenic
1116603824 14:46964027-46964049 CTGTGCCAATTTCTGGGACCAGG + Intronic
1116812083 14:49548920-49548942 CTGTGCCAAGCAGTAAGACAGGG + Intergenic
1118745779 14:68771987-68772009 CTCTGCCTTGCCCTTGGACAGGG + Intergenic
1118768827 14:68928323-68928345 CTGGACAAAGCCCTGGAACATGG + Intronic
1118905768 14:70022110-70022132 CAGTGCCAAGCCCTGGGAACAGG + Intronic
1119616498 14:76102298-76102320 CTGTGCCAAGGCCTTAGGCAGGG - Intergenic
1120469366 14:84903344-84903366 CTCTGTGCAGCCCTGGGACAAGG + Intergenic
1120691622 14:87599158-87599180 CTTTACCAAACCCTGAGACAGGG - Intergenic
1121059400 14:90891182-90891204 CTGTGCCAGGCCCTGGGGTAGGG - Intronic
1121456553 14:94042414-94042436 CTGTGCCAGGCACTGGGGCACGG - Intronic
1121789873 14:96690937-96690959 CTATGCCAAGTGCTGGGACGTGG + Intergenic
1121794254 14:96722387-96722409 CTGCCCCCAGCCCTTGGACATGG - Intergenic
1122143789 14:99676998-99677020 CTGTGCCAAGTTCTGGGAGCTGG + Exonic
1122199822 14:100115628-100115650 CTCTGCTAAGCCCAGGGCCAGGG + Intronic
1122234626 14:100324693-100324715 CTGTGCCTGGCCCTGGGTCATGG + Intronic
1122363327 14:101180244-101180266 CGGTCCCAAGGGCTGGGACATGG - Intergenic
1124240832 15:28026597-28026619 CTGAGCCAAGCCAAGGGGCAGGG - Intronic
1124372720 15:29112519-29112541 CTGTGCTGAGCCCTGGGAGGAGG - Intronic
1125789436 15:42352482-42352504 CTGAGGCAAGCCCTGGCAAATGG - Exonic
1127026653 15:54814666-54814688 CTCTGCAAAGCCTTGGGACATGG + Intergenic
1127539639 15:59924225-59924247 CTGTGCCAAGCCCCGGGTTAAGG + Intergenic
1127746012 15:61973925-61973947 CTGTGTAAAGCCTTGGCACATGG + Intronic
1127808560 15:62543339-62543361 CTATGCCAAGCTCTAGGACAGGG + Intronic
1128341479 15:66825474-66825496 CTGTGCCAAGGCCTTGCACCAGG - Intergenic
1128758901 15:70201567-70201589 CTATGCAAAGCCATGGCACACGG + Intergenic
1129118185 15:73378017-73378039 CTGTGACAAGGGCTGTGACAAGG + Intergenic
1131271557 15:90950365-90950387 CTTTGTCAAGGCCTGGGGCAGGG + Intronic
1131608015 15:93929841-93929863 CTGTTCCCAGCCCTCTGACAAGG + Intergenic
1131905262 15:97135331-97135353 CTGTGCCCCAGCCTGGGACATGG - Intergenic
1132465489 16:75588-75610 CCTTGCCAAACCCTGGGATATGG - Intronic
1132474992 16:130463-130485 CTTTGCCCAGGCCTGGGACCAGG + Intronic
1134049793 16:11129601-11129623 CAGTGCAAGGCCCTGGGGCAGGG - Intronic
1134052169 16:11144877-11144899 CTGTGCTAAGAACTGGGAAATGG + Intronic
1134079363 16:11314448-11314470 CTGTTCCAGGCCCTGGGGCTAGG + Intronic
1134204681 16:12227522-12227544 CTGTGTCAGGCCCTGGGAACTGG + Intronic
1134448040 16:14345594-14345616 CTGTGCCAAGTCTGGGGATAGGG - Intergenic
1135598231 16:23759791-23759813 ATGTGCAAAGCCCTGGAGCAAGG - Intergenic
1136012612 16:27373780-27373802 CTGTTCTAGGCCCTGGGATAAGG - Intergenic
1136709625 16:32225969-32225991 ATTTGCCAAGCCCTGGAACTAGG - Intergenic
1136758284 16:32703442-32703464 ATTTGCCAAGCCCTGGAACTAGG + Intergenic
1136809824 16:33166933-33166955 ATTTGCCAAGCCCTGGAACTAGG - Intergenic
1136816300 16:33277013-33277035 ATTTGCCAAGCCCTGGAACTAGG - Intronic
1138451531 16:57096007-57096029 CTGTTCTAAGTGCTGGGACATGG - Intronic
1138772910 16:59686573-59686595 CTCTGTGAAGCCTTGGGACATGG - Intergenic
1139284515 16:65798444-65798466 CTGTCCCAAGCCCTGTGAGGAGG + Intergenic
1139682396 16:68575163-68575185 CTGTGGCAGGCCCAGGGCCAAGG - Intronic
1140780756 16:78294268-78294290 CTGTGCCAAGCCCAGTGCCGGGG + Intronic
1141466397 16:84208553-84208575 CTGTCCCAACCACTGGGCCACGG - Intergenic
1141763923 16:86046391-86046413 ATGTGCCAGGCCCTGTGCCAGGG + Intergenic
1141967200 16:87453454-87453476 CAGTGCCCAGCCCTGGGAAGAGG + Intronic
1203060435 16_KI270728v1_random:963791-963813 ATTTGCCAAGCCCTGGAACTAGG + Intergenic
1142855541 17:2727436-2727458 CTGTGCCAAGTCCTAGGATATGG - Intergenic
1143270469 17:5671370-5671392 CTGTGCAAAGCCCAGGGCAAGGG + Intergenic
1143628254 17:8122966-8122988 CAGTGGGAAGCCCTGGGACGCGG + Intronic
1144621906 17:16823325-16823347 AAGCGCCAAGCCCTGGGTCACGG - Intergenic
1144884517 17:18449389-18449411 AAGCGCCAAGCCCTGGGTCACGG + Intergenic
1145147712 17:20494988-20495010 AAGCGCCAAGCCCTGGGTCACGG - Intergenic
1145967124 17:28927384-28927406 CTGTTCAAAGCCCTGTCACATGG + Intronic
1147131252 17:38410645-38410667 CTGTGCCAGGCCCTGGAAGTGGG - Intergenic
1147214841 17:38893144-38893166 TTGTGCAGAGCCCAGGGACAGGG + Intronic
1147238456 17:39074769-39074791 CTGAGCCCAGCACTGGGCCAGGG - Intronic
1147990367 17:44328960-44328982 CCAAGGCAAGCCCTGGGACAGGG + Intergenic
1148073094 17:44920043-44920065 CTGTGCCAGGCACTGGGCCAGGG - Intergenic
1148155729 17:45424483-45424505 CAGTGCCAGGCCCTGGGGAATGG - Intronic
1149657391 17:58317482-58317504 CTCTGCCAATGCCTGGGAGAAGG + Intronic
1150387419 17:64773147-64773169 CAGTGCCAGGCCCTGGGGAATGG - Intergenic
1150481568 17:65515450-65515472 CATTTCCAAGCCCAGGGACACGG - Intergenic
1150638068 17:66930514-66930536 CTGTGCCCAGCCCTAAGACTAGG - Intergenic
1150646514 17:66981539-66981561 TTGTGCAAAGCACTGGGTCAGGG + Intronic
1151928298 17:77214582-77214604 GTGTGTCTGGCCCTGGGACAAGG - Intronic
1151936238 17:77263366-77263388 CTGTTCCAACCCCAGGGTCAGGG - Intergenic
1151969644 17:77451092-77451114 CTCTGGCAAGCACAGGGACAAGG + Intronic
1152154048 17:78621542-78621564 CTCTGCCGACTCCTGGGACACGG - Intergenic
1152358918 17:79821129-79821151 CTGTGAGCAGCCCTGGGCCAGGG + Intergenic
1152571551 17:81123358-81123380 CTGTGCCCAGCCCTGGCTCACGG - Intronic
1152572058 17:81125216-81125238 CTGTGCCCAACCCTGAGACCTGG + Intronic
1152730866 17:81969263-81969285 CTGTCCCAGGCACGGGGACATGG + Intergenic
1152892259 17:82889196-82889218 CTGTGCCCGGCCCTGGGACTCGG + Intronic
1154055191 18:11006067-11006089 CTGTTCCAAGACCTGAGCCAAGG - Intronic
1154356507 18:13625914-13625936 CTGTCCCAGGCCAAGGGACATGG - Intronic
1155038073 18:22042114-22042136 CTGTGCCAAGCACTGTGCTAGGG - Intergenic
1155154997 18:23150568-23150590 CTGTGCCAAGCACTGGGATATGG + Intronic
1155170915 18:23266322-23266344 GTATGCCAGGCCCTGGGCCAGGG - Intronic
1156828945 18:41467405-41467427 TTGTGCCATGCTCTGGGAAAGGG - Intergenic
1157799954 18:50611005-50611027 GTGTGTCCAGCCCTGGGCCAGGG + Intronic
1158908601 18:62037893-62037915 ATATGCCAAGCCCTGTGCCAGGG - Intergenic
1159558457 18:69969058-69969080 CTGTGCCAAGCACTAGGGCTTGG - Intergenic
1160236319 18:77088991-77089013 CTGCGCCAGGCCCTGTGACAAGG - Intronic
1161334687 19:3706354-3706376 CTGTGCTAGGCCATAGGACACGG + Intergenic
1161520070 19:4718927-4718949 TCGTGCCAGGCCCTGAGACATGG + Intronic
1162061333 19:8097253-8097275 CTGTTCCCAGCCCTGGGGCCTGG - Intronic
1162968361 19:14166274-14166296 CTGTCCCCAGCCCTGGGAGGGGG - Intronic
1163055838 19:14716936-14716958 CTGTGCCATGCCCTGACACCAGG - Intronic
1163604040 19:18264559-18264581 CTGAGCCAGGCCCTGTGTCAGGG - Exonic
1164708153 19:30335582-30335604 ATGTGCCAGGCACTGGGAAAGGG - Intronic
1164907837 19:31981987-31982009 ATGTGCCAACCCCTGGGAGGAGG - Intergenic
1165060125 19:33201121-33201143 CTGTGCAGGGCCCTGGGACATGG + Intronic
1165487440 19:36104139-36104161 TTGTGCTAAACCCTGGGACATGG + Intronic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1165831957 19:38734919-38734941 CTGGGCCAAGCCCTGTGCTAGGG + Intronic
1166067034 19:40366053-40366075 CTTTTCTCAGCCCTGGGACAGGG - Intronic
1166130698 19:40744046-40744068 CTCTCCCAGGCCCTGGGATACGG + Exonic
1167197901 19:48043451-48043473 CTGTGCCCAGCCCTGTGCAAAGG - Intronic
1167439654 19:49500822-49500844 CTGAGCCCAGCACTGGTACAAGG + Intergenic
925846992 2:8043484-8043506 CAGAGCCATGCCCTGGGATAGGG + Intergenic
925929925 2:8698743-8698765 CTGTGCTAGACCCTGGGATACGG - Intergenic
926001972 2:9340511-9340533 CTGAGCCAAGCACTGAGCCATGG - Intronic
926114618 2:10204549-10204571 CTGTGCCCAGCCCTGGGTGCAGG + Intronic
926344261 2:11930971-11930993 ATGTGCCAGGCACTGGGAAACGG - Intergenic
926488117 2:13488817-13488839 CTATTCCAAGCCATGGGAAAAGG + Intergenic
926656468 2:15412738-15412760 CTGTGTCAAACCCTGGCAAATGG + Intronic
926679235 2:15651337-15651359 CTTGGCCAGGCACTGGGACAGGG - Intergenic
926766230 2:16325069-16325091 TTATGCCCAGCCCAGGGACAGGG - Intergenic
927114228 2:19885815-19885837 CTCTGCCCCACCCTGGGACACGG + Intergenic
927149759 2:20188852-20188874 CTGCGCCTGGCCCTGGGAGAAGG - Intergenic
927751195 2:25672801-25672823 CTGTGCCAGGCCTTGGGATTAGG - Intronic
929591449 2:43150125-43150147 CAGTGCCAAGCCCTGTGCTAAGG - Intergenic
931285013 2:60824822-60824844 CTGTACCAAGCACTGTGCCAAGG + Intergenic
932213844 2:69953428-69953450 CTGTGCCATGCACGGGCACAAGG - Intergenic
932277466 2:70462360-70462382 ATGTGTTCAGCCCTGGGACAGGG - Intronic
932310217 2:70733883-70733905 CTGTGGAAAGCACTGGGACTTGG - Intronic
932956459 2:76357031-76357053 CTCTGTGCAGCCCTGGGACATGG + Intergenic
933343238 2:81049213-81049235 CTTCACAAAGCCCTGGGACATGG + Intergenic
935678593 2:105617267-105617289 CTCTGGGAAGCCCTGGGACCAGG - Intergenic
936142008 2:109948593-109948615 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936178696 2:110246541-110246563 CTGTGCCAGGCACTGTGCCAGGG - Intergenic
936202682 2:110422891-110422913 CTGTGCCAGGCACTGTGCCAGGG + Intronic
937779259 2:125818753-125818775 CTTAGCCAGGCCCTGGGGCAAGG + Intergenic
937824127 2:126346088-126346110 GTGTGCCAAGCACTTGAACATGG - Intergenic
938070303 2:128304931-128304953 CTGTGGCAACCCATGGAACATGG + Intronic
938116878 2:128608299-128608321 CTGTGCCAAGCTCCTGGACTTGG - Intergenic
938569697 2:132551406-132551428 ATGTGTCAAGCCCTGGGGGAAGG - Intronic
940533372 2:154907829-154907851 GAGTCCCAAGCCCTGGGACAGGG - Intergenic
940597664 2:155815711-155815733 ATGTCCCAAGCACTGAGACAAGG + Intergenic
940633707 2:156271006-156271028 AAGTGCCATGCCCTGGGACCAGG - Intergenic
943576504 2:189637309-189637331 CTGTGTCAGGCACTGGAACAGGG + Intergenic
946495965 2:220195779-220195801 CTGAGGCCAGGCCTGGGACAAGG + Intergenic
947915328 2:233828783-233828805 CTGTGCCTGGCCCTGGGCCCAGG + Intronic
947988574 2:234468914-234468936 CTTTGCCAAGCCATGAGATAAGG + Intergenic
948283244 2:236764828-236764850 ATGGGCCAAGCCCTGGGAATTGG - Intergenic
948515327 2:238499935-238499957 ATGTGCCCAGTCCTGGGACCCGG + Intergenic
948582369 2:238996883-238996905 CTCGGCCATGCCATGGGACAAGG + Intergenic
949082214 2:242111483-242111505 CTCTGACAAGCCCAAGGACAGGG - Intergenic
1168934878 20:1656567-1656589 TTGTGCCCAGCCCTGTGACCGGG + Intronic
1168967872 20:1910189-1910211 CTGTGCCAGGCCCTGAGCTAAGG - Intronic
1169011280 20:2252939-2252961 CCGGGCCAAGCCATGGGGCAGGG + Intergenic
1171293171 20:23994167-23994189 CTATGCTAAGCCCTGGGACATGG - Intergenic
1172698937 20:36840897-36840919 CTGTGCTAAGCGCAGGGGCAGGG + Intronic
1172922657 20:38498747-38498769 CTGTTCTAAGCCCTGGAACCAGG - Intronic
1172950036 20:38717295-38717317 CTGAGGCAACTCCTGGGACAGGG - Intergenic
1174533346 20:51232000-51232022 CCCTGCCCAGCCCTGGGAAATGG + Intergenic
1175080384 20:56415126-56415148 GTTTGCCAACCCCTGGTACAAGG - Intronic
1175101627 20:56583370-56583392 CTGTGGAAGTCCCTGGGACAGGG + Intergenic
1175299127 20:57930384-57930406 CTGGGCTAAGCATTGGGACAGGG + Intergenic
1175441870 20:58997942-58997964 CTCTGCCAAGGCCTGGGGAAGGG - Intronic
1175545705 20:59776441-59776463 CTGAGCCAGGCCCTGTGCCAAGG - Intronic
1175578138 20:60078164-60078186 CTGAGTCAAGCCCAGGGAGAAGG + Intergenic
1175760650 20:61560532-61560554 CTGGGCCAAGTCCTTGGCCAAGG + Intronic
1175855100 20:62116827-62116849 CTTTCCCAAGCACTGGAACATGG - Intergenic
1176187927 20:63791652-63791674 CCCTGCCCAGCACTGGGACAGGG + Intronic
1176232789 20:64040595-64040617 CTGCCCCAACCCCTGGGCCATGG + Intronic
1177206392 21:18016228-18016250 CTCTGTGCAGCCCTGGGACATGG + Intronic
1178622161 21:34186430-34186452 CGGTGCCAAGCTCTGGGAAGAGG + Intergenic
1178781156 21:35604400-35604422 CAGTGCCAAGCCCCTGGGCATGG - Intronic
1179809441 21:43861010-43861032 ATGAGCCAGGCCCTGGGAAAGGG - Intergenic
1179830944 21:43995567-43995589 TTGTACCAAGTCCTGGGACTCGG - Intergenic
1180824228 22:18851881-18851903 CTATGCTAAGCCCTGGGACATGG - Intronic
1180984032 22:19893583-19893605 CTGTGCCCAGGCCTGGGCCGGGG - Intronic
1181093218 22:20488516-20488538 CTGTGCCAAGTGCTGGGATGGGG + Intronic
1181124656 22:20695035-20695057 CTATGCTAAGCCCTGGGACATGG - Intergenic
1181188508 22:21122667-21122689 CTATGCTAAGCCCTGGGACATGG + Intergenic
1181210692 22:21287826-21287848 CTATGCTAAGCCCTGGGACATGG - Intergenic
1181274948 22:21682383-21682405 CTGCCCCAAGCCTTGGCACAGGG - Intronic
1181398818 22:22639062-22639084 CTATGCTAAGCCCTGGGACGTGG + Intergenic
1181501549 22:23318418-23318440 CTATGCTAAGCCCTGGGACATGG + Intergenic
1181650604 22:24256997-24257019 CTATGCTAAGCCCTGGGACATGG - Intergenic
1181706777 22:24653741-24653763 CTATGCTAAGCCCTGGGACATGG + Intergenic
1181764005 22:25078195-25078217 ATGTGCCAGGCACTGGGCCAAGG - Intronic
1182007961 22:26977227-26977249 CTGTGCCAGGCACTGTGATAAGG - Intergenic
1182880212 22:33726623-33726645 CTGTGCCAAGCACTGAGCCAGGG + Intronic
1183089733 22:35513692-35513714 AAGTGCAAAGCCCTGGGAGAGGG + Intergenic
1183270157 22:36857115-36857137 CTCTGAGAAGCCCTGGCACACGG - Intergenic
1183329834 22:37213426-37213448 CTGGGCCATTCCCTGGGACCAGG + Intergenic
1183376582 22:37468920-37468942 CTGTGCCAGGCTCTGTAACATGG + Intergenic
1183429561 22:37757513-37757535 GTGTGCCAGGCCCTGTGCCAGGG - Intronic
1183576305 22:38692137-38692159 CTGTGCCAAGCACTATGATAAGG + Intronic
1183710644 22:39501505-39501527 CTCTGCCAAGCCCAGGGCCTGGG - Intronic
1184197551 22:42940558-42940580 ATGAGCCCCGCCCTGGGACAGGG + Intronic
1184337600 22:43862844-43862866 CTGTGCCAGGCACTGGGCCAGGG + Intergenic
1184377492 22:44123902-44123924 CTGTGCCAGGCACTGTGCCAGGG - Intronic
1184449872 22:44576519-44576541 CGGTCCCCAGCCCTGGGAAAGGG + Intergenic
1184652832 22:45926940-45926962 CTGTGCCAAGACGTGGGACATGG + Intronic
1185010123 22:48308247-48308269 CTGTGCCAGGCCCTGGGTGAAGG + Intergenic
1203216255 22_KI270731v1_random:7604-7626 CTATGCTAAGCCCTGGGACATGG + Intergenic
1203274365 22_KI270734v1_random:77785-77807 CTATGCTAAGCCCTGGGACGTGG - Intergenic
949962006 3:9320044-9320066 CTGAGCCAATCCATGTGACAGGG - Intronic
950057103 3:10034032-10034054 CTGTGCCCAGCCCAGAGTCATGG - Intronic
950205385 3:11076275-11076297 CTGTCCTAAGCTCTGGGAGATGG - Intergenic
950525448 3:13520301-13520323 CTGTGCCAGGCCTTGGGAGAGGG - Intergenic
952406135 3:33006825-33006847 CTGTGCCAGGGCCTTTGACAAGG + Intronic
952953627 3:38543364-38543386 CTGTGCCAGGTGCTGGGGCAGGG + Intergenic
953451670 3:43011539-43011561 CTGTGTGAAGCCATGGGAAATGG + Intronic
953576804 3:44119371-44119393 CTGTGCCACCCCCTGGAACTAGG - Intergenic
954106028 3:48410238-48410260 CTGTGCCCAGCCCGGAGTCATGG - Intronic
954241445 3:49296915-49296937 CTGTGCCAAGGGCTAGAACATGG - Intronic
954419834 3:50412951-50412973 CTGTCCCAAGTCCTGGGCCCTGG - Intronic
955152251 3:56379416-56379438 CTGTGCCAGGCACTGAGCCAAGG + Intronic
956903779 3:73744282-73744304 CTGTACTAAGCACTGGCACATGG + Intergenic
958636727 3:96754926-96754948 CTGTGCCAAGCTCCAGCACAGGG - Intergenic
958943425 3:100338206-100338228 CTGTGCTCAGCCCTGGAGCAAGG - Intronic
960001432 3:112735651-112735673 CTGTGCAGAGGCTTGGGACACGG - Intergenic
960265539 3:115616836-115616858 GGGTGCCAAGCCATGGAACAGGG + Intergenic
960534540 3:118802190-118802212 CTGTGCCAATGCTTGGCACAAGG - Intergenic
961336964 3:126186447-126186469 CTGTCCCTGGCCCTGGGCCATGG - Intronic
961345968 3:126263628-126263650 CTGTGCCCAGCACTGGGGCTAGG - Intergenic
961658012 3:128453840-128453862 GAGTGCCAGGCCCAGGGACATGG + Intergenic
961819789 3:129570147-129570169 CTGTGCCAGGCCCAGGACCAAGG - Intronic
964310962 3:155391868-155391890 CTGTGCAAAGCTTTGGGCCAAGG + Intronic
964704609 3:159604496-159604518 CTGTGCCAGGCACTGTGCCAGGG + Intronic
967188264 3:186963885-186963907 CTGTCCCAAGCCCTGGTGCCAGG + Exonic
967416770 3:189227412-189227434 CTGAGCAAAGCCCTGTGCCAGGG - Intronic
967622586 3:191651076-191651098 CTGTGTGAAGCCCAGGGACTTGG - Intergenic
968003577 3:195224398-195224420 CTATGCCAGGCTCTTGGACAGGG + Intronic
968425301 4:519298-519320 CTGTGCCAGGCGCTGTGCCAGGG - Intronic
968951008 4:3691468-3691490 TTATGCCAAACCCTGGGATATGG - Intergenic
969017722 4:4115591-4115613 AGGTCCCAAGCCCTGGCACACGG - Intergenic
969436258 4:7191367-7191389 CTGTACCCAGCGCTGGGACTTGG - Intergenic
969509477 4:7609615-7609637 ATGTGCCAGGCCCTAGGCCAAGG - Intronic
969699685 4:8761344-8761366 CTGGGCCAAGCCCACGGCCAGGG + Intergenic
970035617 4:11732277-11732299 CTGTGCCAGGCCCTCGGTTAGGG + Intergenic
970426926 4:15954222-15954244 CTGTGCGCAGCCTTGGGACTTGG - Intergenic
971017644 4:22505225-22505247 TTGTGCCCAGCAGTGGGACATGG + Intronic
971284414 4:25273894-25273916 ATTTGCCAAGCCCAGGGAGAGGG - Intronic
972340240 4:38146447-38146469 CTGTCCCATGCCCTGGAACTGGG - Intergenic
973218679 4:47700656-47700678 CTGTGCCAAGCCAGGGTACAGGG + Intronic
974794130 4:66726950-66726972 CTGTGCCAAGCACTGTGCCAAGG + Intergenic
975111195 4:70628715-70628737 CTGTGCCAAGCTTTCTGACAAGG + Intergenic
975357788 4:73428419-73428441 CAGTGCCAAGCCCAAAGACATGG - Intergenic
976118271 4:81751629-81751651 CACTGCCAAGCCCTGCCACAGGG + Intronic
979636956 4:122966744-122966766 CTATGCCAAGTACTGTGACATGG - Intronic
980463539 4:133148095-133148117 CAGAGCTAAGCCCTGGGCCAGGG + Intergenic
981915341 4:150026949-150026971 CTGTGCACAGCCTTGGGACTTGG + Intergenic
982100813 4:151965902-151965924 CTGTTCCCAGCTCTGGGGCAAGG - Intergenic
982277966 4:153656214-153656236 CTGTGCCAGGAACTGGTACAGGG - Intergenic
982378116 4:154717021-154717043 CTGTGCTAGGCACTGGGCCACGG - Intronic
982556875 4:156878070-156878092 ATGTGCCATGCCTTGGGGCATGG - Intronic
983723871 4:170893706-170893728 CTGTGTGCAGCCCTGGGACTTGG - Intergenic
983921975 4:173355923-173355945 CTGTGCCCAGCCTAGAGACAAGG - Intergenic
984754502 4:183313168-183313190 CAGTGCCAAGCTCTGGCGCATGG + Intronic
987052140 5:14156246-14156268 CTGATCCCAGCCCTGGGGCAAGG - Intronic
988379447 5:30481245-30481267 CTGTGTCCAGCCTTGGGACTTGG - Intergenic
988514994 5:31896525-31896547 ATGTGCCAAGCCCTGTGCTAAGG + Intronic
990075773 5:51844066-51844088 CTGTGTGCAGCCTTGGGACATGG - Intergenic
990491088 5:56303704-56303726 CTGGTCCAAGGCCTGGGAGATGG + Intergenic
992128556 5:73667466-73667488 GAGTGCCAAGTCCTGGGAGAAGG - Intronic
992611482 5:78511887-78511909 CTGTGCCAAGCACTGGGTAAGGG + Intronic
993967203 5:94372596-94372618 CTCTGTGCAGCCCTGGGACATGG - Intronic
995770321 5:115662822-115662844 CTGTGCCTGGCCCTGGACCATGG + Intergenic
997143482 5:131407479-131407501 ACGTGCCAAACCCTGTGACATGG - Intergenic
997214188 5:132096747-132096769 CTGTCAAATGCCCTGGGACAGGG + Intergenic
998052957 5:139051609-139051631 ATGTGCCAAGCCCTGGCCTAAGG - Intronic
998560185 5:143164277-143164299 CTGTGCCTTGCCATGGGTCAGGG + Intronic
999825519 5:155269928-155269950 CTGTGCTAGGCCCTGGCAGATGG - Intergenic
999897480 5:156050988-156051010 ATGTGCCAATCCCTGGGACAAGG - Intronic
1000306107 5:159996062-159996084 CTGTTCCTCTCCCTGGGACATGG + Intergenic
1000836955 5:166167084-166167106 CTGTGCCCAGCCCTGTGCAATGG - Intergenic
1001380703 5:171304702-171304724 CTGGACCCAGCCCTGGGACATGG + Intergenic
1001634276 5:173198508-173198530 CTGTGGCCAGCCCTGTGCCAAGG - Intergenic
1001942209 5:175748815-175748837 ATGGGCCCAGCCCTGGGACTCGG + Intergenic
1001964788 5:175902598-175902620 CTGTGCCAAGGCCAGGGCCCTGG + Intergenic
1002252162 5:177936590-177936612 CTGTGCCAAGGCCAGGGCCCTGG - Intergenic
1003171069 6:3722552-3722574 CTGTCCCCTGCCTTGGGACAGGG - Intergenic
1003176012 6:3752323-3752345 CCGCGCCAAGGCCTGGGACACGG + Intergenic
1003507548 6:6752119-6752141 CTGTGCAAAGCACTGAGCCATGG + Intergenic
1003635613 6:7828941-7828963 CTGTGCCAAGCCCTGGGACACGG - Intronic
1004003572 6:11618889-11618911 CCGTGCCTAGCCCTAGGTCAAGG - Intergenic
1004360714 6:14968288-14968310 GTGTGCCAAGCACTGGGCTAGGG + Intergenic
1005451037 6:25972639-25972661 CTGTGCACAGCCCTGAGACTGGG - Intronic
1005679260 6:28189351-28189373 TTGTGCCAAGACCTGGGAGTGGG + Intergenic
1006375775 6:33670990-33671012 CTGTTCCAATGCCTGGGAAAGGG + Intronic
1006556666 6:34872856-34872878 CTATGGGAAGCTCTGGGACATGG - Exonic
1007284392 6:40737157-40737179 CTGTGCCAGGTGCTGGGACTCGG + Intergenic
1007324624 6:41050469-41050491 CTGTGCGCAGCCCTGGGAATAGG + Intronic
1007345017 6:41222826-41222848 CAGCGCCAGGCCCTGGGACAGGG + Intergenic
1007554156 6:42752331-42752353 CTGTGCCCAGCACTGAGCCAGGG + Intronic
1007615334 6:43176454-43176476 GTGTGCCAGACCCTGGGACTGGG + Intronic
1007716026 6:43856679-43856701 CTTTCCCTAGCCTTGGGACAAGG + Intergenic
1009703834 6:67219617-67219639 GTGTGGCAAGCCTTGGGAGATGG - Intergenic
1009828121 6:68894166-68894188 ATGTGCCAAGCAATGGGTCATGG - Intronic
1010741607 6:79512377-79512399 CAGTGCCATGCCCAGGGACGGGG - Intronic
1011521219 6:88208991-88209013 CTGGGCCAATCACTGGGACCAGG - Intergenic
1012706530 6:102538768-102538790 CTGTGTGCAGCCTTGGGACATGG + Intergenic
1013286888 6:108689602-108689624 CTGTGCCAGGCCCTGGCCCTCGG + Intergenic
1013626527 6:111942908-111942930 CTGTGCTGAGCACTGGAACAAGG - Intergenic
1013838185 6:114357831-114357853 CCATGCAAAGCACTGGGACATGG + Intergenic
1016613722 6:146023936-146023958 CTCTGTGAAGCCCTGGGACTTGG + Intergenic
1018039000 6:159905188-159905210 CTGTGCTAGGCACTGGGACATGG - Intergenic
1018293918 6:162324564-162324586 CTTTGCTAAGCACTGGCACAGGG + Intronic
1019147594 6:169984974-169984996 CTGTCCCAGGCCCTGCGACTAGG - Intergenic
1019380965 7:723301-723323 CTGGCCAAAGCCCTGGGAAAGGG - Intronic
1019558669 7:1645198-1645220 ACCTGCCAAGCCCTGGGCCAGGG - Intergenic
1019897512 7:3994267-3994289 GTCTGATAAGCCCTGGGACATGG - Intronic
1019987461 7:4668176-4668198 CTGTGCCCAGGCCTGGGCTAAGG - Intergenic
1023033749 7:36112543-36112565 CTGAGACCAGCCCTGGCACATGG - Intergenic
1023083449 7:36546874-36546896 CTGTGCCAGGCTCTAGGATATGG - Intronic
1023109250 7:36793447-36793469 CTGTGCAAAGCACTGTGCCAAGG - Intergenic
1023831127 7:44039565-44039587 CTGCGCCACGCCCTGGCGCACGG + Intergenic
1024165058 7:46722716-46722738 CTGTGCATACCCCTGGGAAAGGG + Intronic
1024655913 7:51451309-51451331 CTGCACCAAGACCTGGCACAAGG - Intergenic
1025019517 7:55469803-55469825 CTGTGTCCATCCCTGGGAGACGG - Intronic
1025610095 7:63070614-63070636 CTGTGACCAGCCCTGTGACTGGG - Intergenic
1026146827 7:67753837-67753859 TGGTGCCAAAACCTGGGACAGGG - Intergenic
1026972739 7:74477962-74477984 CGGTGCCAACCCCTGGGGCCAGG - Intronic
1028941738 7:96529122-96529144 GTTAGCCAAACCCTGGGACATGG - Intronic
1029448409 7:100627387-100627409 CTGGGCCACGGCCTGGGCCACGG + Exonic
1029612701 7:101635797-101635819 CTGACCCAAGCCCTGGGGGAGGG + Intergenic
1029741455 7:102493871-102493893 CTGCGCCACGCCCTGGTGCACGG + Exonic
1029759447 7:102593040-102593062 CTGCGCCACGCCCTGGCGCACGG + Exonic
1029776814 7:102688950-102688972 CTGCGCCACGCCCTGGCGCACGG + Intergenic
1029874885 7:103739879-103739901 CTGTTCCCAGTCCTGGGCCATGG - Intronic
1030076722 7:105743267-105743289 CTGTGCCAAGAACTGGGGCCAGG + Intronic
1030902540 7:115142055-115142077 CTGTGCCAAGACCTGTTCCAAGG + Intergenic
1032000748 7:128263618-128263640 CTGAGCCAATCACTGGGACCAGG + Intergenic
1032708103 7:134439659-134439681 GTGTGCAAGGCCTTGGGACAGGG + Intergenic
1033345680 7:140523976-140523998 CAGTGCCAAGCCCTTTCACAGGG - Intronic
1033822607 7:145152178-145152200 CTGTGCTAGGCCCTGGTCCAAGG - Intergenic
1034480213 7:151314084-151314106 CTGTGCCAAGAACTGGGAGGCGG - Intergenic
1034551438 7:151823080-151823102 CTGTGACAAGCCAGGGGTCAGGG - Intronic
1034586229 7:152094930-152094952 CTGTGCCCAGCCCTGGAAGAAGG + Intronic
1034782485 7:153893399-153893421 CTGTGCAAAGCCCTTGTCCATGG - Intronic
1034996389 7:155579942-155579964 CTTTGCCAAGCTCCGTGACATGG + Intergenic
1035010415 7:155710858-155710880 CTGAGCAAAGCCCTGTGCCAGGG - Intronic
1035033304 7:155878552-155878574 CTGTTCCTAGCCCTGGGACGTGG + Intergenic
1035057093 7:156042869-156042891 CTGTGCAGAGCCCTTGGATAAGG - Intergenic
1035304362 7:157921682-157921704 CTGCGCCATGCCCTGGAAGAAGG - Intronic
1035875964 8:3189940-3189962 CTGTGCCAAGGCGTTGGGCACGG + Exonic
1039061083 8:33572712-33572734 CTGTGCCAAGCCCTGTGCTCAGG + Intergenic
1039404024 8:37297457-37297479 CTGTTTGAAGCCCTGTGACAGGG - Intergenic
1041424349 8:57703469-57703491 CTGTGCCAAGTCCTTGGCCAAGG + Intergenic
1042857868 8:73285776-73285798 CCGTGGCCAGCCCTGCGACAAGG - Intergenic
1042871518 8:73404455-73404477 CTGGGCGAAGCCCTGTGTCAAGG - Intergenic
1044835042 8:96287583-96287605 TTGGGCCATGCCCTGGGTCACGG + Intronic
1044875666 8:96663498-96663520 CTGTGCCAAGCTGTGGACCATGG + Intronic
1045036045 8:98177169-98177191 CAGTGCCAAGTGCTGGGGCAGGG - Intergenic
1045385868 8:101670468-101670490 CTGTGCCTAGACCAGGGACTGGG + Intergenic
1046868489 8:119177293-119177315 CTGTGCCAGGCACTAGGGCATGG + Intronic
1047918474 8:129608360-129608382 CTGAGCCAAGCCCTGGTACTAGG + Intergenic
1048182394 8:132208144-132208166 CTGTACCAAACCCTGTGTCAAGG + Intronic
1049784127 8:144442524-144442546 CTGTGCCACACACTGGGAGAAGG - Intronic
1050992475 9:12171334-12171356 ATGTGCTCACCCCTGGGACAAGG - Intergenic
1051925188 9:22316856-22316878 CTCTGTGAAGCCTTGGGACATGG + Intergenic
1052494550 9:29211637-29211659 CTGAGCCAATCCCTCGGAAAAGG + Intergenic
1052618108 9:30869146-30869168 CTGAGTGAAGCCCTGAGACATGG - Intergenic
1053053556 9:34980289-34980311 CTTTGCCAGGCCCTGGAATACGG - Exonic
1053288778 9:36866490-36866512 CTCTCCCAGGCCCTGGGACCTGG - Intronic
1056458292 9:86784593-86784615 CAGTGCCCCGTCCTGGGACATGG + Intergenic
1057808625 9:98240516-98240538 CTGTGCTGAGCCCTGTTACATGG + Intronic
1058706599 9:107642576-107642598 CTGAGACAAGCCCTGGGGAATGG + Intergenic
1059705873 9:116822787-116822809 CTGTCCTAAGCCCTGGAACTTGG + Intronic
1060186770 9:121568395-121568417 ATGTGCCAAGCCCTGTGTCAGGG + Intronic
1060202079 9:121657156-121657178 CTGTCGCATGCCCTGGGAAAGGG - Intronic
1060236145 9:121864003-121864025 CTGTGGCAAGCTTTGGGATATGG + Intronic
1060785513 9:126449153-126449175 ATGTGCCCAGCCCTGGGGCCTGG + Intronic
1061543851 9:131292385-131292407 TTATGCAAAGCCCTGGAACACGG - Intronic
1062054495 9:134463813-134463835 CTGGGCCAAGCCCTGGGAACAGG - Intergenic
1062139238 9:134946190-134946212 CTGGGCCACTCCTTGGGACAGGG + Intergenic
1062183111 9:135201650-135201672 CTGAGCCAAGGAATGGGACAGGG + Intergenic
1062582155 9:137233500-137233522 CTGGGCCCTGTCCTGGGACAGGG + Intronic
1062597194 9:137304702-137304724 CTGTTCCAAATGCTGGGACACGG + Intergenic
1062730245 9:138104502-138104524 CTGTGCAAAGCCCTGGGACTAGG + Intronic
1189272296 X:39759990-39760012 CTGGGCAAAGCCCTGGTCCACGG - Intergenic
1189613386 X:42761805-42761827 CTGTGCCAAGTCCTTAGAAATGG - Intergenic
1189849715 X:45166274-45166296 CCGTGCCAAGTACTGGGCCAGGG + Intronic
1190691280 X:52915570-52915592 CGGTGCCAACCCATGAGACAAGG + Intergenic
1190694703 X:52940222-52940244 CGGTGCCAACCCATGAGACAAGG - Intronic
1190931548 X:54952871-54952893 GTGTGCCAAGCAGTGGGGCATGG + Intronic
1192054940 X:67763804-67763826 CTGTGCCAGGCCCTGTTTCAGGG + Intergenic
1192090070 X:68144793-68144815 CTGTGCCAAGCCCTGTTTCAAGG + Intronic
1192205302 X:69091838-69091860 CTGTGCCAAGCACTGTTTCAAGG + Intergenic
1193175610 X:78388822-78388844 CTCTGTGAAGCCTTGGGACATGG - Intergenic
1193996007 X:88366479-88366501 CTCTGCTCAGCCTTGGGACATGG - Intergenic
1194071262 X:89328878-89328900 GTGTCTCAAGCACTGGGACATGG - Intergenic
1196522176 X:116687010-116687032 CTGTGTGCAGCCTTGGGACATGG + Intergenic
1197712705 X:129683231-129683253 CTGTGCTAAGCCCTGGGCATAGG + Intergenic
1197758117 X:130010336-130010358 CTATGCCCAGCCTTGGGCCAGGG - Intronic
1198405102 X:136304569-136304591 CTGTGCTAACTCCTGGGGCAGGG + Intronic
1199041952 X:143124703-143124725 TTGTTCCAAGCCCTGGGCCTCGG - Intergenic
1199681729 X:150229411-150229433 CTGTGCCAAGCCCTGTGCTGAGG - Intergenic
1199856651 X:151764306-151764328 CTGTGCTGAGCCCTGGGAGAGGG + Intergenic
1200117835 X:153776939-153776961 CTGGGCCAGGCTCTGGGAGATGG - Exonic
1200149194 X:153943125-153943147 CTGTGCCATCCCCCTGGACACGG + Intronic
1200725495 Y:6664616-6664638 GTGTCTCAAGCACTGGGACATGG - Intergenic