ID: 1003637750

View in Genome Browser
Species Human (GRCh38)
Location 6:7848842-7848864
Sequence TTGTGTCCTTGTGATGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003637750 Original CRISPR TTGTGTCCTTGTGATGATGC AGG Intronic
905293904 1:36942221-36942243 CTCTGTGCTGGTGATGATGCTGG + Intronic
906333285 1:44906253-44906275 TTGTGTACTTGGGATAATTCTGG - Intronic
906547563 1:46631422-46631444 TTATGTGTTTGTGGTGATGCTGG - Intergenic
906929268 1:50153014-50153036 TTGTGCCCATGTGTTGCTGCAGG + Intronic
907655792 1:56340670-56340692 TTGTGCCATTGTGGTGTTGCAGG - Intergenic
909004322 1:70257194-70257216 TTATGTGTTTGTGGTGATGCTGG + Intergenic
910049372 1:82957498-82957520 TTGTGTGCTGGTGATGTGGCTGG - Intergenic
911875851 1:103162128-103162150 TTGTGTCATTGAAATGTTGCTGG + Intergenic
914246859 1:145892638-145892660 TTGAGTCCTAGGGATGCTGCTGG - Exonic
915282291 1:154830765-154830787 TGGTGTCCTGGTCATCATGCTGG - Intronic
916118106 1:161505266-161505288 TTGTGTCCTTGTGAAAACCCCGG - Intergenic
916284743 1:163093866-163093888 TTCTGTCCTTGTGATAAGGCAGG + Intergenic
917790385 1:178495627-178495649 TTGAGCCCTTGTGATGTGGCTGG - Intergenic
919014255 1:192010129-192010151 TTATGTGTTTGTGGTGATGCTGG - Intergenic
923261171 1:232269389-232269411 TACTGTCCTGGAGATGATGCTGG + Intergenic
1065164890 10:22966067-22966089 TTGTGTCCTTCTGAGGATTGTGG + Intronic
1066441584 10:35444586-35444608 TCCTGTGTTTGTGATGATGCTGG - Intronic
1066515647 10:36156962-36156984 TTGTGTGTTTGTGGTGATGCTGG - Intergenic
1066637500 10:37520727-37520749 TTGTTTCTTTGTGCTGATGAGGG - Intergenic
1066757751 10:38727917-38727939 TTGTGTGTTTCTGGTGATGCTGG + Intergenic
1068049912 10:51936687-51936709 AAGTGTACTTGTTATGATGCTGG + Intronic
1069623210 10:69850625-69850647 TGTTGTCCTTGTGATGCTGAGGG + Intronic
1071361297 10:84848629-84848651 GTGTGTCCTTGTGGTTAGGCTGG - Intergenic
1072304109 10:94090454-94090476 TTGTGTCCGTGTCCTGACGCAGG + Intronic
1073387446 10:103138045-103138067 TTTTGTCCTTATGAGGATGTGGG - Intronic
1074296110 10:112191206-112191228 AAGTGTCTTTGTGATGAGGCAGG + Intronic
1074342771 10:112650634-112650656 TCGTGTGTTTGTGGTGATGCTGG - Intronic
1075407502 10:122204376-122204398 CTGAGCCCTTGTGCTGATGCTGG + Intronic
1076660077 10:132049966-132049988 TTGTTTCGTTTTGATGATGGAGG + Intergenic
1077557047 11:3230858-3230880 GGGTGTCCTCCTGATGATGCTGG - Intronic
1078113903 11:8426044-8426066 CTCTGTCCTTGTGATGAGGCAGG - Intronic
1080370361 11:31632371-31632393 TGTTGGCATTGTGATGATGCAGG - Exonic
1081341620 11:41935107-41935129 TTGTGTCCCTTTGATAAAGCTGG + Intergenic
1083110916 11:60405715-60405737 TTGTGTCTTTCTGATGAGGCAGG - Intronic
1084955324 11:72688302-72688324 GTGTGTCCAGGTGATGCTGCTGG + Intronic
1087089542 11:94254331-94254353 TTGCGTGTTTGTGGTGATGCTGG - Intergenic
1087804819 11:102544446-102544468 TTGTGTCATTGTGATAATCATGG + Intergenic
1087816497 11:102664374-102664396 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
1088189255 11:107209184-107209206 CTGTTTCATTGTGATGCTGCTGG + Intergenic
1088944636 11:114496863-114496885 TTACGTCTTTGTGCTGATGCTGG + Intergenic
1090472443 11:126992062-126992084 TTATGTTCTTATGATGATGATGG - Intronic
1090493261 11:127184874-127184896 TTGTGTACTTATGTTGAAGCAGG + Intergenic
1090751971 11:129754450-129754472 TTTTGGCATTGGGATGATGCTGG - Intergenic
1090841329 11:130489925-130489947 TCATGTGTTTGTGATGATGCTGG + Intergenic
1091006834 11:131961227-131961249 TTTTGTCCTGTTGATTATGCAGG + Intronic
1093654378 12:21677684-21677706 TTCTGTCCTTGAGATAAGGCAGG + Intronic
1094617635 12:32050177-32050199 TGGTGTGTTTGTGGTGATGCTGG + Intergenic
1096250157 12:50025943-50025965 TGGAGTGCTTGTGATGATGTGGG - Intronic
1097422461 12:59397142-59397164 TCATGTGCTTGTGGTGATGCTGG + Intergenic
1098556565 12:71825515-71825537 CTGTGTCCCTGTTAAGATGCTGG - Intergenic
1098576092 12:72043874-72043896 CTGTGTCCTTGTGGTTATGATGG + Intronic
1098646361 12:72906639-72906661 TTGTGTTCTTTTGATAATTCAGG + Intergenic
1102830043 12:115989803-115989825 TAGTGTCCTTGTGAAGAAGGTGG - Intronic
1105673401 13:22644373-22644395 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1105724424 13:23147646-23147668 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1106347050 13:28889106-28889128 TTAATTCCTTGTGATGATGGTGG + Intronic
1106437834 13:29739543-29739565 TTGTATCCTAGTGATGCTGAGGG - Intergenic
1106542182 13:30699902-30699924 TTGTTTCCATGTCATGATGAAGG + Intergenic
1106994530 13:35466363-35466385 TTGTGTCTTTGTGAATATGTTGG + Intronic
1109104799 13:58237474-58237496 TTATGTGTTTGTGGTGATGCTGG - Intergenic
1111198027 13:84898703-84898725 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1111879285 13:93935093-93935115 TTGTGTACATGTGTTGTTGCTGG + Intronic
1113142533 13:107170335-107170357 TTGTGTCCTTGTTTGGATTCAGG + Exonic
1117159478 14:52974468-52974490 TTGTGTCCTTGTGGAGTTGAAGG + Intergenic
1119142013 14:72275914-72275936 TTTTCCCCTTGTGCTGATGCTGG - Intronic
1119815440 14:77562489-77562511 TTCTGTTCCTGTGATGTTGCAGG - Exonic
1121889881 14:97579824-97579846 TTGTCTTCATGTTATGATGCAGG + Intergenic
1122507627 14:102241810-102241832 TTGTGTCCTGGAGATGTGGCTGG - Intronic
1122760416 14:104020781-104020803 TTGTGGCTCTGTGATGATGTGGG + Intronic
1122841088 14:104463457-104463479 TTGGGTGGGTGTGATGATGCTGG + Intergenic
1125347728 15:38735510-38735532 TTATGTCTTTGTGGTGATGCTGG + Intergenic
1126429343 15:48564220-48564242 TGGTGTCTGTGTGATGATGAAGG - Intronic
1127047753 15:55044885-55044907 TTGTGTCCAAGTGATGGTGCAGG + Intergenic
1127815975 15:62609033-62609055 TTGTGGGCTTGTGATGGTGGTGG + Intronic
1128332612 15:66765699-66765721 TTGTGGCTTTATGATGATGGGGG + Intronic
1128571483 15:68736666-68736688 TTGTGTCTTTGTGATGAAAGGGG - Intergenic
1130135153 15:81176291-81176313 TTGTGATCTTGGGATGATGCTGG + Intronic
1130235767 15:82132215-82132237 CTGTGTCCTGGTGCTGAGGCAGG + Intronic
1133022831 16:2974376-2974398 TTCTGTCCTTGTCATGATGCTGG - Exonic
1134610866 16:15606885-15606907 TTGTCTGCTTGTGAAGATGGAGG - Intronic
1136018251 16:27420241-27420263 TCATGGGCTTGTGATGATGCTGG - Intronic
1136369226 16:29825595-29825617 TGGGGTCCTGGTGCTGATGCAGG + Intronic
1139654075 16:68376903-68376925 TTCTGTCCTTATGATCATCCTGG - Intronic
1140873181 16:79125613-79125635 TTGTCTCCTTGGGAGGATGCAGG - Intronic
1141210582 16:81975905-81975927 TTTTGTCCTTTTGTTGTTGCTGG - Intergenic
1141974659 16:87507564-87507586 ATGAGTCCATGTGATGATCCGGG - Intergenic
1142247623 16:88977093-88977115 CTGTGTCCCCGTGATAATGCCGG + Exonic
1143290226 17:5822655-5822677 CTCTGTCCTTGTGATAAAGCAGG - Intronic
1144370044 17:14581615-14581637 TCATGTCTTTGTGGTGATGCTGG + Intergenic
1144658541 17:17053352-17053374 TTGGGTCCTGATGAGGATGCAGG + Intronic
1145834320 17:27942627-27942649 GTGTGTCCTAGTGATGTGGCAGG - Intergenic
1146913191 17:36661063-36661085 TTGTCTCCTGGTGATGCTGGGGG + Intergenic
1148223271 17:45880188-45880210 TCCTGTGTTTGTGATGATGCCGG - Intergenic
1152264022 17:79283007-79283029 TTGTGTGCCTGTGATGCTGGTGG - Intronic
1152324654 17:79628436-79628458 CTGCGGCCTTGTGATGAAGCAGG - Intergenic
1153427769 18:4986013-4986035 TTTTCTCTTTGTGATGATACAGG + Intergenic
1154305689 18:13229181-13229203 TGGTGTCCTTGGGACGATTCGGG + Intronic
1156326013 18:36076054-36076076 TCATGTGCTTGTTATGATGCTGG + Intergenic
1157289175 18:46397913-46397935 TGGTGTGTGTGTGATGATGCTGG + Intronic
1160286127 18:77545102-77545124 GTGGGTTCTTGTGAGGATGCAGG + Intergenic
1162186387 19:8908369-8908391 TTGTGTTCATGTGATGATGGTGG - Intronic
1162637827 19:11984341-11984363 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1163405134 19:17117247-17117269 TTGTTTCCTAGTGATTATCCAGG + Intronic
1168662856 19:58181698-58181720 TTGCTTCCTTGTGATTATGAAGG + Intergenic
925141527 2:1553117-1553139 TTCAGTCTTTGTGATGGTGCAGG + Intergenic
926390616 2:12387700-12387722 TTGTGTGTTTGTGGTGATGCTGG - Intergenic
927422301 2:22946324-22946346 TTGTGTGTTTGTGGTGATGCTGG - Intergenic
927584036 2:24282511-24282533 TTCTGTCCTTGTGATAAGGAAGG + Intronic
928437556 2:31265357-31265379 TTATGTGTTTGTGGTGATGCTGG - Intronic
928819360 2:35342320-35342342 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
930144559 2:47988286-47988308 TCATGTGTTTGTGATGATGCTGG + Intergenic
931423096 2:62146117-62146139 TTATGTGTTTGTGGTGATGCTGG + Intronic
932525608 2:72463952-72463974 TTGTGGCCATGTGAGGATACGGG - Intronic
932554732 2:72812173-72812195 TTGTATCTTTGTGATCTTGCTGG - Intronic
933187149 2:79290874-79290896 CTCTGTCCTTGTGATAAGGCAGG + Intronic
933315242 2:80706947-80706969 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
933466486 2:82658325-82658347 TTCCGTCCTTGTGATAAGGCTGG + Intergenic
934957087 2:98631807-98631829 TTCTGTCCTTGTGATAAGGCAGG + Intronic
935221421 2:101017428-101017450 TGATGTTTTTGTGATGATGCTGG - Intronic
936833810 2:116682321-116682343 TTATGTGCTTGTATTGATGCTGG + Intergenic
937139820 2:119590433-119590455 TGGTGTCCTTGTGCTCATGCTGG - Intronic
940599913 2:155845630-155845652 TTCTGTCCTTGTGATAAGGAAGG + Intergenic
943390736 2:187264820-187264842 TTGTTTCCTTGTGATAGTGCAGG + Intergenic
944706893 2:202298813-202298835 TGGTGAGGTTGTGATGATGCAGG + Intronic
946142128 2:217700378-217700400 TTTGGTCCTTGTGATAATGATGG - Intronic
946981939 2:225227743-225227765 TTGTGTCATTTTGATGATAGAGG + Intergenic
947411250 2:229842962-229842984 TTGTGTCTTAATGGTGATGCTGG - Intronic
947720096 2:232365013-232365035 TCATGTCCTTCTGATGCTGCAGG - Intergenic
947732714 2:232440000-232440022 TCATGTCCTTCTGATGCTGCAGG - Intergenic
948925038 2:241090583-241090605 TTTTGTGTTTGTGGTGATGCTGG - Intronic
949060459 2:241953651-241953673 TTGTGGCCCCGTGATGCTGCAGG + Intergenic
1169865733 20:10197888-10197910 TTTTCTCCTGGTGATGATGATGG + Intergenic
1170133355 20:13046562-13046584 TTGTGTCCCTGTGATGCAGAAGG + Intronic
1170284830 20:14695394-14695416 TTGAGACCTTGAGATGATCCCGG - Intronic
1170599798 20:17832464-17832486 TTGTGTGTTTGTGGGGATGCTGG + Intergenic
1170959478 20:21012453-21012475 TTTTGTCCTTTTGCTGATGTAGG + Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1177662227 21:24099870-24099892 TTGTGGTATTGGGATGATGCTGG + Intergenic
1179015294 21:37590537-37590559 TTGTGTCCTGGAGATGTGGCTGG + Intergenic
1180780872 22:18518724-18518746 TTCTGTCCATGTGATGAGGTGGG + Intergenic
1181040630 22:20190924-20190946 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
1181466845 22:23114980-23115002 CTGTGTCCCAGGGATGATGCTGG + Intronic
1181666605 22:24402593-24402615 TGGTGTCCTTGTGAAGCTGGAGG + Intronic
1184934102 22:47706471-47706493 CTGTGTCCTTGTGATAAGGAAGG - Intergenic
949831629 3:8221249-8221271 TTATGTGTTTGTGGTGATGCCGG - Intergenic
951316328 3:21192725-21192747 TTGTGTCCTGGAGATGTGGCTGG + Intergenic
951545962 3:23825636-23825658 TTGGGTCCTTGTCATCATTCAGG - Intronic
951904673 3:27692880-27692902 GTGTGTCCTTGCCATGTTGCAGG - Intergenic
952426480 3:33179948-33179970 TTATGTGTTTGTGGTGATGCTGG + Intronic
952726359 3:36590114-36590136 TTATGTGTTTGTGGTGATGCTGG - Intergenic
952890752 3:38038831-38038853 GTGTGTGTTTGTGATGATGGCGG - Intergenic
955336484 3:58090529-58090551 TCATGTATTTGTGATGATGCTGG - Intronic
955835597 3:63051294-63051316 TATTGTCCTTGTGATCATCCAGG - Intergenic
956194136 3:66635220-66635242 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
956778639 3:72587293-72587315 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
957327371 3:78713857-78713879 TTGAGTGTTTGTTATGATGCAGG + Intronic
958644751 3:96855453-96855475 TTGTGTACTTGGGCAGATGCTGG + Intronic
959583458 3:108004590-108004612 TTCTGTCCTTGTGATAAGGCAGG + Intergenic
960515208 3:118595637-118595659 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
961711635 3:128832718-128832740 TTGTGTGCTGGAGATGTTGCTGG + Intergenic
964009432 3:151872459-151872481 TTGAGTTCTTGTGATGTGGCAGG - Intergenic
964308005 3:155361557-155361579 TTCTGTCCTTGCGATAAGGCAGG - Intergenic
964423083 3:156524961-156524983 TTGTGTGTTTGTGGTGATGCTGG + Intronic
964593969 3:158400242-158400264 TTATGTGTTTGTGGTGATGCTGG + Intronic
964780659 3:160333941-160333963 TTATGTGTTTGTGTTGATGCTGG - Intronic
966451921 3:180073060-180073082 TTGTGTCTTTGTGATGAGTGGGG - Intergenic
967252206 3:187551903-187551925 TTTTGCCCTTGGGTTGATGCTGG + Intergenic
969497824 4:7535988-7536010 ATGTTTCCCTGTGATGCTGCTGG + Intronic
970749636 4:19342138-19342160 TACTGTCCTTGTGATAATGAGGG + Intergenic
970954435 4:21794006-21794028 TTCTGTCCTTGTGAGAATGATGG - Intronic
971230523 4:24797406-24797428 TAATGTTCTTGTGAGGATGCAGG + Intronic
971965218 4:33545615-33545637 TTCTGTATTTGTGGTGATGCTGG + Intergenic
972794788 4:42404692-42404714 ATTTGTCTTTGTCATGATGCTGG - Intergenic
973057425 4:45678679-45678701 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
973537022 4:51893759-51893781 AAGTGTCCTTGTGATGATGAAGG + Intronic
973978024 4:56282609-56282631 TTGGATCCTGGTGATGTTGCTGG - Intronic
974250076 4:59374768-59374790 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
974250615 4:59378552-59378574 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
974752084 4:66154465-66154487 TTCTGTCCTTGTGATAAAGATGG + Intergenic
975514974 4:75237093-75237115 ATGTGTCCCTGTGCTGATGAGGG - Intergenic
976802956 4:89013638-89013660 TTATGTGTTTGTGGTGATGCTGG + Intronic
977991107 4:103443543-103443565 TCATGTGTTTGTGATGATGCTGG + Intergenic
978818393 4:112935384-112935406 TTGAGTCCTTCTGATGGGGCAGG + Intronic
979862110 4:125707186-125707208 CTGTGTCCTTGTGATAAGGAAGG - Intergenic
980276826 4:130663470-130663492 TTGTTTCCTTGTGGTGGTACTGG - Intergenic
980485466 4:133451268-133451290 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
980737637 4:136911973-136911995 TTGTGTTCTTGTGTTGGTGAGGG - Intergenic
981036994 4:140181908-140181930 TCATGTGTTTGTGATGATGCTGG + Intergenic
981276263 4:142901108-142901130 TTTTGTCCATGAGATGAGGCTGG - Intergenic
983042464 4:162945935-162945957 TCATGTCTTTGTGGTGATGCTGG + Intergenic
983422302 4:167534474-167534496 TTGTATGTTTATGATGATGCTGG + Intergenic
985725118 5:1512055-1512077 CTGTGTCCTGGTGGTGATGTGGG - Intronic
985810384 5:2079093-2079115 TGCTGTCCTTGTGATAATGGGGG + Intergenic
986365304 5:7022908-7022930 CTCTGTCCTTGTGATAATGCAGG - Intergenic
987947923 5:24637513-24637535 TTTTGTCCTTGAGAAGAGGCAGG - Intronic
988526073 5:31988418-31988440 TTCTGTCCTTGTGGAGATGGGGG + Intronic
989743877 5:44804975-44804997 TTGTGACTATGTGATTATGCAGG + Intergenic
991120030 5:63001934-63001956 TTGTAGCCTTGTGATGATAAAGG + Intergenic
991354270 5:65751337-65751359 ATGTTTACTTGTGATGATGAGGG + Intronic
992912357 5:81408433-81408455 ATGAGTCCTTGTTGTGATGCAGG + Intergenic
993160174 5:84280148-84280170 TTGTTTCCTTGTGATGCCCCAGG + Intronic
993297900 5:86166890-86166912 TCGTGTGTTTGTGTTGATGCTGG - Intergenic
993786828 5:92149820-92149842 TTTTTTCCTTGTGAAGATGTAGG + Intergenic
994301897 5:98157342-98157364 TTCTGTCCTTGTGATAAGGAAGG - Intergenic
994455653 5:100003748-100003770 TTGTGTGTTTGTGTTGATGCTGG + Intergenic
994578885 5:101613710-101613732 GTGTGTGTTTGTGATGTTGCAGG - Intergenic
994837402 5:104873028-104873050 TTGTGTGTTTGTGGTGATGCTGG + Intergenic
995230036 5:109750254-109750276 TTGTGTCCTTCTGATGTTTTTGG + Intronic
995278713 5:110308250-110308272 TGCTGTCCTTGTGATGGTGTGGG + Intronic
996932627 5:128908566-128908588 TTCTGTCTTTCTGATGATTCAGG + Intronic
999007272 5:147996675-147996697 TTCTGTCCTTGTGATAAGGAAGG - Intergenic
1001946070 5:175779166-175779188 CTGTGTCCTTGAGAACATGCTGG + Intergenic
1002028479 5:176411681-176411703 TTGAGTCCTTGTTATGTTCCAGG - Intronic
1003637750 6:7848842-7848864 TTGTGTCCTTGTGATGATGCAGG + Intronic
1003785588 6:9482724-9482746 TCATGTCTTTTTGATGATGCAGG - Intergenic
1003924672 6:10866181-10866203 TTGTGTGTTTATGGTGATGCTGG + Intronic
1004527528 6:16423387-16423409 CTGGGTCCTTGTGATGTTCCAGG + Intronic
1004578654 6:16925519-16925541 TTGCGTGTTTGTGGTGATGCTGG - Intergenic
1005105058 6:22214961-22214983 TTGTGTGTCTGTGGTGATGCCGG + Intergenic
1007307598 6:40919042-40919064 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
1007741836 6:44015615-44015637 TTATGTCTTTGTAGTGATGCTGG + Intergenic
1007941412 6:45785056-45785078 GAGTGTCCTTGAGGTGATGCGGG - Intergenic
1008353501 6:50521926-50521948 TTGTTTCCTTCTGAAGAAGCAGG - Intergenic
1009557909 6:65198513-65198535 TCGTGTGTTTGTGGTGATGCAGG - Intronic
1011399517 6:86944846-86944868 TCATGTGCTTGTGATGAGGCTGG + Intronic
1011759120 6:90540966-90540988 TTGTGTACTTGAGATGAAGGTGG + Intronic
1012543452 6:100390395-100390417 TTGTGTCCTTGTGCTGGGTCTGG + Exonic
1014247222 6:119081549-119081571 CTCTGTCCTTGTGATAAGGCAGG - Intronic
1014717991 6:124887925-124887947 TTCTGTCCTTGTGATAAGGAGGG + Intergenic
1016446479 6:144138130-144138152 TTGTGTCCTAGGGATAAAGCTGG - Intergenic
1018093547 6:160365598-160365620 TTTTTTCATTGTGATGATGATGG + Intronic
1019229820 6:170550708-170550730 TTGTGTGTTTGTGATGATTTTGG - Intronic
1021393610 7:20122782-20122804 TTGTGTCCTGGAGATGTGGCTGG - Intergenic
1021495889 7:21274286-21274308 TTGTGACCTAGTGATGCTGTAGG - Intergenic
1024837597 7:53541212-53541234 TTGTGTCCTTATCATGCTTCAGG + Intergenic
1026922149 7:74163778-74163800 CTGTGTCCTGGTGGAGATGCTGG + Intergenic
1028273688 7:88824310-88824332 TTGTGTTCTTGTGTTGTTGATGG + Intronic
1031898052 7:127376469-127376491 TTGTCTCTGTGTGATGAGGCTGG - Intronic
1032417753 7:131750344-131750366 AAGTGTCCTCGTGATGATGTTGG + Intergenic
1033050454 7:137999874-137999896 TTCTGTCATTGTGATAAAGCAGG - Intronic
1033249940 7:139749842-139749864 TTCTGTCCTTGTGAAGATGTTGG - Intronic
1035177263 7:157060312-157060334 TTGTGTCCCTGTATTGATTCTGG + Intergenic
1035403368 7:158583162-158583184 TTTTGTCCTAGTGTTCATGCGGG - Intronic
1037149511 8:15618803-15618825 TCCTGTGCTTGTGGTGATGCTGG - Intronic
1037445849 8:18965235-18965257 TAATGTCCTTCTGAAGATGCTGG + Intronic
1037550458 8:19965925-19965947 TTGTAACTTTGTCATGATGCAGG - Exonic
1038248616 8:25882059-25882081 CTCTGTCCTTGTGATAAGGCAGG + Intronic
1039076221 8:33692884-33692906 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1040718926 8:50293202-50293224 TTGTGTCCCTGTGATTCTGAAGG + Intronic
1042242509 8:66678661-66678683 TTGAGTGCTTGTGATGAACCTGG + Intronic
1043872480 8:85449405-85449427 TTGTGCCTTTAGGATGATGCTGG + Intergenic
1044085317 8:87936294-87936316 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1044280823 8:90353861-90353883 TCATGTTTTTGTGATGATGCTGG - Intergenic
1046329053 8:112690458-112690480 TCGTGTCCTGGTCATGATTCAGG - Intronic
1049417364 8:142501377-142501399 TTGTGTGGTTTTGATGATGGAGG + Intronic
1050037524 9:1452994-1453016 CTGTGTCCTGGTTATGATGGTGG + Intergenic
1051092309 9:13424352-13424374 CTCTGTCCTTGTGATAAGGCAGG + Intergenic
1051484516 9:17593537-17593559 TTGTGTCCTTGTAAGGATGTAGG - Intronic
1051569950 9:18544528-18544550 TGGTCTCCATGGGATGATGCTGG - Intronic
1052566510 9:30160390-30160412 TTCTGTCCTTGTGATAAGGCAGG - Intergenic
1052893525 9:33725713-33725735 TTTTGGCATTGGGATGATGCTGG - Intergenic
1057764558 9:97905384-97905406 TTGTGGCTTTCTGAGGATGCTGG - Intronic
1058026219 9:100144224-100144246 TTGTGTGCTGGTGATGTGGCTGG + Intronic
1059084456 9:111285004-111285026 TTGTTTTCTTGTGAAGATGGGGG - Intergenic
1059370577 9:113829219-113829241 TATTGTCCTTTTGATGTTGCAGG - Intergenic
1059526653 9:114997524-114997546 TTATGTGTTTGTGGTGATGCTGG + Intergenic
1059537455 9:115094875-115094897 TTATGTGCTGGGGATGATGCAGG + Intronic
1060026118 9:120173299-120173321 TTGTGTACTTGATTTGATGCTGG + Intergenic
1186589574 X:10915759-10915781 TTGTCTCCTTGTGATGACTAAGG - Intergenic
1187937834 X:24353211-24353233 TTGGGTCATTGTAATGAAGCTGG - Intergenic
1188084817 X:25890942-25890964 TCATGTATTTGTGATGATGCTGG - Intergenic
1193293532 X:79806381-79806403 TTGTGTCCTTGTGGGGGTGGGGG + Intergenic
1193294594 X:79819895-79819917 TTTTGTTTTTGTGATGGTGCAGG + Intergenic
1193416357 X:81229392-81229414 CTCTGTCCTTGTGATAAGGCAGG - Intronic
1194221645 X:91200500-91200522 TTCTGTCCTTGTGATAAGGAAGG + Intergenic
1194390928 X:93317043-93317065 TTTTGTTATTGGGATGATGCTGG + Intergenic
1196710895 X:118761381-118761403 TTGTCACCTTATGATGATGATGG + Intronic
1197167230 X:123391766-123391788 CTTTGTCCTGGTGATGATGGTGG + Intronic
1198167539 X:134072255-134072277 CTCTGTCCTTGTGATAAGGCAGG - Intergenic
1199005948 X:142695738-142695760 CTGTGTCCTTGAGAGGAGGCTGG + Intergenic
1200558160 Y:4664256-4664278 TTCTGTCCTTGTGATAAGGAAGG + Intergenic