ID: 1003639648

View in Genome Browser
Species Human (GRCh38)
Location 6:7865842-7865864
Sequence GATCCCTGGTGGGCTGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003639648_1003639651 -10 Left 1003639648 6:7865842-7865864 CCAGAAGCAGCCCACCAGGGATC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1003639651 6:7865855-7865877 ACCAGGGATCGTCCTACATCTGG 0: 1
1: 0
2: 0
3: 2
4: 60
1003639648_1003639653 -9 Left 1003639648 6:7865842-7865864 CCAGAAGCAGCCCACCAGGGATC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1003639653 6:7865856-7865878 CCAGGGATCGTCCTACATCTGGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003639648 Original CRISPR GATCCCTGGTGGGCTGCTTC TGG (reversed) Intronic
903404963 1:23088538-23088560 GCTCCTTGGTGGGTTGTTTCTGG - Exonic
904324915 1:29722104-29722126 CATCCCTGGAGGGATCCTTCTGG + Intergenic
904658067 1:32064267-32064289 AATCCCTGGTGGGCTGGGACCGG + Intergenic
909337871 1:74496971-74496993 GATCCCTGGTTTTCTTCTTCTGG - Intronic
913592233 1:120341065-120341087 GAGCCCGGCGGGGCTGCTTCCGG - Intergenic
914598573 1:149176881-149176903 GAGCCCGGCGGGGCTGCTTCCGG + Intergenic
922571570 1:226637548-226637570 GGTCCCTGATGGCCTGCCTCTGG + Intronic
1063779489 10:9304926-9304948 AATCCCTGCTGGGCTGCCTAAGG + Intergenic
1064234424 10:13560876-13560898 GGTCCCTGATGGGGAGCTTCTGG + Intergenic
1064254582 10:13732927-13732949 AATCCCTGTGGGGCTTCTTCTGG + Intronic
1065187728 10:23185282-23185304 GATCTCTGGAGGGCTCCTCCAGG + Intergenic
1069688324 10:70333597-70333619 GACCCCTGCATGGCTGCTTCTGG - Intronic
1071468541 10:85962172-85962194 GGTCCCTGGTGGGCTCCTACAGG + Intronic
1074180696 10:111060170-111060192 CAGCCCTGGAGGGCTGCTCCTGG + Intergenic
1077663066 11:4086317-4086339 GACCCCTGGTGGGAGGTTTCTGG + Intronic
1078007688 11:7544885-7544907 TCTCCCTGGTGTGTTGCTTCTGG + Intronic
1078466671 11:11555171-11555193 GATCCCTGATGGGCTGCTCAGGG + Intronic
1078872227 11:15358406-15358428 GAACCCTGGTGGGCTGTTGATGG + Intergenic
1085051416 11:73382102-73382124 GAACCCTGGTGGGTTGCTCCAGG + Intronic
1088795318 11:113262513-113262535 TAACCCTGCTGTGCTGCTTCTGG + Intronic
1096509183 12:52118045-52118067 GGTCTCTGGTGGGAAGCTTCTGG + Intergenic
1099202182 12:79690273-79690295 GAGCCCTGGTGGGCGGCCTGAGG - Exonic
1101751602 12:107586641-107586663 GATCCCTGGGGAGTTGCTTTGGG + Intronic
1102028054 12:109724599-109724621 GAACCCTGGCAGGTTGCTTCAGG - Intronic
1107532740 13:41300096-41300118 GATCACTGGAGGTCTGCTTTAGG + Intergenic
1113422328 13:110180416-110180438 GATCCCAGGGGGGTTTCTTCCGG - Intronic
1113676955 13:112214186-112214208 TAGCCCTGGTGGGCTGACTCAGG + Intergenic
1113774841 13:112938032-112938054 GAGCCCTGATGGGCTGGTTCAGG + Intronic
1119410356 14:74426301-74426323 AGTGCCTGGTGGGCTGATTCCGG - Intergenic
1120521559 14:85532192-85532214 GATCCCTGGGGGGTTGGTCCTGG + Intronic
1121660972 14:95634846-95634868 ACTCCCTGCTGGGCTGCTTCTGG + Intergenic
1121824141 14:96996857-96996879 CATCCCTGGTGGGAAGCTTCTGG + Intergenic
1121999110 14:98631531-98631553 GGTCACTGGTGGTCTGCTGCTGG - Intergenic
1122619014 14:103042812-103042834 GAACCCTTGTGGGCTGCTGGTGG + Intronic
1122945753 14:105008125-105008147 GATCCCTGCTGGGCCACATCTGG - Intronic
1124094683 15:26638152-26638174 GAACCCTGGTGGGCTGATGAGGG - Intronic
1128315321 15:66656043-66656065 GAAACCTCCTGGGCTGCTTCAGG - Intronic
1128578630 15:68793156-68793178 GCTCCCTGGTAGGCTGATTACGG - Intronic
1138426727 16:56939238-56939260 AATGCCTGCTGGGCAGCTTCAGG - Exonic
1138848611 16:60598469-60598491 GATCCCTGGGGGGCGGGTTGTGG + Intergenic
1141692119 16:85602405-85602427 GATCCCTGGGAGGCTTCTTGGGG + Intergenic
1141710891 16:85698392-85698414 GACCCCAGGTGGGCTGCTCCGGG + Intronic
1142396894 16:89837237-89837259 GTTCCCTGGTCTGCTGCTGCAGG + Intronic
1142694478 17:1626205-1626227 CCTCCCTGGTGGGCTCTTTCAGG - Intronic
1145919365 17:28599033-28599055 GCTTCCTGGTTGGCTGCTTCAGG + Exonic
1146528153 17:33584597-33584619 CAGCCCTGGTTGGCTGCTCCAGG - Intronic
1147441811 17:40452225-40452247 GATCCCTGGTGCCCTGGTTCTGG + Intronic
1151923215 17:77173442-77173464 GATCCCATGTGGGTTGCTTAGGG + Intronic
1152510776 17:80786033-80786055 TATCCCTGGGGGACTGGTTCCGG - Intronic
1152718964 17:81913470-81913492 GATGCCTGGTGGGAAGCATCTGG - Intronic
1156701960 18:39836370-39836392 GATCACTGCTGGTCTGTTTCAGG + Intergenic
1158609426 18:58925227-58925249 GATCCCTCGTGTGTTGCTCCTGG - Intronic
1159324481 18:66896588-66896610 GGTCACTGGTGGTCTGCTGCTGG - Intergenic
1163196927 19:15728468-15728490 CCTGCCTGGTGGGCTGCTCCTGG + Exonic
1163206545 19:15807591-15807613 CCTGCCTGGTGGGCTGCTCCTGG - Exonic
1167282230 19:48576215-48576237 TATCCCTGGGAGGCTACTTCTGG - Intronic
925298029 2:2791169-2791191 GATCCGTGTTGGGCAGCTCCAGG + Intergenic
925367166 2:3318358-3318380 GAGCCGTCGTGGGCTGCTCCAGG + Intronic
927353845 2:22151315-22151337 GGTTCCTGGAGGGCTGATTCTGG + Intergenic
928133341 2:28669267-28669289 GAGGCCTGGAGGCCTGCTTCAGG - Intergenic
929195841 2:39183461-39183483 GAGCCCTGGTTGGCTGCCTAAGG - Intronic
929532618 2:42762272-42762294 GAGCCCTGGTGGCCTGCCTGAGG + Intergenic
931721904 2:65072717-65072739 GATCCTTGGAGGGCAGCTCCAGG - Exonic
932091173 2:68807711-68807733 GAACCCTGCTGGGCAGATTCAGG + Intronic
936523945 2:113230220-113230242 GTGCCCTGCAGGGCTGCTTCTGG + Intronic
936774473 2:115956224-115956246 GGTCACTGGTGGTCTGCTGCCGG - Intergenic
942583560 2:177448847-177448869 GATTCCTGGGGGGTTGCTTAAGG - Intronic
948857590 2:240737216-240737238 GGACCCTGGGGGGCTGCCTCAGG + Intronic
1169142540 20:3234445-3234467 GCTCCCTGTTGAGCTGCTCCTGG + Intronic
1169677240 20:8167893-8167915 GGTCTCAGGTGGGCTCCTTCTGG + Intronic
1170914571 20:20610378-20610400 GATACCTGGTGAGCTGCCTGGGG - Intronic
1172423972 20:34842542-34842564 GATCTCTGGTAAGTTGCTTCGGG + Intergenic
1173906280 20:46632005-46632027 GCTCCCTGCTGGGCTGCAGCTGG + Intronic
1175795598 20:61768954-61768976 GGGCCCTGGTGAGCTGCTGCTGG + Intronic
1176419392 21:6501772-6501794 AATCCCTGAAGGCCTGCTTCAGG - Intergenic
1178000843 21:28160644-28160666 GTTGCCTAGTGGGATGCTTCTGG - Intergenic
1179694885 21:43110094-43110116 AATCCCTGAAGGCCTGCTTCAGG - Intergenic
1179922831 21:44516418-44516440 GATTCCTGGTGGGCGGCTTCTGG + Intronic
1180107424 21:45629358-45629380 GGTCCCTGGAGAGCTGTTTCTGG - Intergenic
1181576883 22:23800880-23800902 GATTCCTGGTGGGCAGGATCAGG + Intronic
1182294158 22:29303380-29303402 GCTCCCATGTGGGCTCCTTCTGG - Intergenic
1184744506 22:46448352-46448374 TACCCCTGGGGGGCTGCTCCAGG + Intronic
1185043658 22:48518195-48518217 GATCCCACGTGGGCTCCTGCGGG - Intronic
1185326180 22:50226910-50226932 TGTCCCTGGAGGGCTGCTGCCGG - Intronic
949733060 3:7136587-7136609 GGTCTCTGATGGGCTGCTTTAGG - Intronic
956542590 3:70358487-70358509 GATCCCTAGTGCAATGCTTCTGG + Intergenic
961332186 3:126148947-126148969 GAGCCCTGATTGGCTGGTTCAGG - Intronic
961662692 3:128478150-128478172 GATCCCTGATGGTCTGCATTTGG - Intergenic
963507870 3:146209804-146209826 CATCACTTGTGGGCTGCTTGTGG - Intronic
964488313 3:157208642-157208664 GATCCCTGGTTGGAGGCCTCTGG - Intergenic
969451014 4:7273413-7273435 CATTGCTGGAGGGCTGCTTCTGG + Intronic
969610923 4:8227457-8227479 GGGCCCTGGAGGGCAGCTTCGGG + Exonic
973616572 4:52684825-52684847 GATCACTGGAGATCTGCTTCAGG - Intergenic
974100703 4:57412778-57412800 GGATCTTGGTGGGCTGCTTCTGG + Intergenic
980704499 4:136475187-136475209 TAACCCTGGGGGGCTGCCTCTGG - Intergenic
982259312 4:153480586-153480608 GAACCCTGGTGAGATACTTCAGG - Intronic
987221120 5:15791605-15791627 GTTCCCTGGTGGGTAGCTCCTGG + Intronic
988618064 5:32794295-32794317 GATCCCTGCTAGGCTCCCTCTGG + Intergenic
997013284 5:129904217-129904239 GATCCCTGTCGGGCCGCCTCCGG - Intergenic
1003639648 6:7865842-7865864 GATCCCTGGTGGGCTGCTTCTGG - Intronic
1004378967 6:15115861-15115883 TTTCCTTGGTGGGCTGCTTTCGG - Intergenic
1005426932 6:25712717-25712739 GATCCCTGATTGGTTGGTTCAGG + Intergenic
1006436345 6:34027801-34027823 GCCCCCTGGTGGCCTGCCTCGGG + Intronic
1007763573 6:44148410-44148432 GAGCCCTGGAGGGCTGCTCAGGG - Intronic
1010720194 6:79274663-79274685 GGTCCGTGGTGGTCTGCCTCTGG - Intergenic
1013877550 6:114851581-114851603 GAGCTCTAGTGGGCTGCTTGTGG - Intergenic
1018411565 6:163554132-163554154 GAACCCTAGCTGGCTGCTTCTGG + Intronic
1019716388 7:2541347-2541369 GGACCCTGGCGGGCTGCGTCCGG - Exonic
1020051793 7:5086664-5086686 GAGCCCTTGTGGGGGGCTTCAGG - Intergenic
1022660575 7:32362748-32362770 GAGGCATCGTGGGCTGCTTCTGG - Intergenic
1023607046 7:41940669-41940691 GCTCCCAGGTGGGCTGCTGTGGG + Intergenic
1023716711 7:43052363-43052385 GGTCCCTGGTGGGATGTGTCTGG + Intergenic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1023843716 7:44109847-44109869 GATTCCAGGTGGGCTGGTGCAGG + Intronic
1028512280 7:91638473-91638495 GATCCCAGGTGGCATGCATCTGG - Intergenic
1029147853 7:98459272-98459294 GAGGCCTGGCTGGCTGCTTCGGG + Intergenic
1029904787 7:104080504-104080526 TATCCCTGGTAGCCTCCTTCTGG - Intergenic
1032495529 7:132358995-132359017 GAGCCCAGGTGGTCTGATTCTGG - Intronic
1033269217 7:139915654-139915676 GATCCCTCATGGGATGCTTACGG - Intronic
1034781813 7:153888052-153888074 GAGCCCTGGGGGTCTGCTTGGGG - Intronic
1038362715 8:26898489-26898511 GCTCCCTGCTGTGCTTCTTCTGG + Intergenic
1044782593 8:95758752-95758774 GACCCCAGGTGGGCTGCCTGGGG - Intergenic
1047666470 8:127097131-127097153 GATACCTGGTGGGCTGTCCCAGG - Intergenic
1049838928 8:144758023-144758045 GGCCCCTGGTTGGCTGCGTCTGG - Intergenic
1051815511 9:21100781-21100803 GATCTCTTGTGGGCTGCTTTTGG - Intergenic
1052829742 9:33205339-33205361 GGTCTCTGCTGGGCTGCTTCTGG + Intergenic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1053901883 9:42803791-42803813 GATCCATGTTGGAATGCTTCAGG + Intergenic
1059405023 9:114094117-114094139 CATCACTGCTAGGCTGCTTCTGG - Intronic
1061385311 9:130286135-130286157 CTTCCCTGGCCGGCTGCTTCAGG - Intronic
1189243192 X:39541417-39541439 AATGCCTGGTGCTCTGCTTCTGG - Intergenic
1191112543 X:56817468-56817490 GTTCACTGGTTGGCTGCTGCAGG - Intergenic
1191721446 X:64231842-64231864 GATCCCTAGAGGGCTGTTTTGGG - Intergenic
1193443770 X:81574936-81574958 GAACCCTTGTGTGCTGTTTCAGG + Intergenic
1195348304 X:103973365-103973387 GAGCTCTGGTTGGTTGCTTCAGG - Intergenic
1195359138 X:104065476-104065498 GAGCTCTGGTTGGTTGCTTCAGG + Intergenic
1200105012 X:153707183-153707205 GGTGCCTGGGGGGCTGCTGCAGG - Intronic
1200317116 X:155145864-155145886 GATACCTGGTAGGCTTCTTTGGG - Intronic
1202191865 Y:22253922-22253944 GATCCCTGGCCTGCTGCCTCTGG - Intergenic