ID: 1003640843 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:7873946-7873968 |
| Sequence | CTTCACAAGCAGAATGAGGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1003640839_1003640843 | 10 | Left | 1003640839 | 6:7873913-7873935 | CCTAGCACGAGACGGTATTTTGG | 0: 1 1: 0 2: 0 3: 0 4: 24 |
||
| Right | 1003640843 | 6:7873946-7873968 | CTTCACAAGCAGAATGAGGTTGG | No data | ||||
| 1003640838_1003640843 | 11 | Left | 1003640838 | 6:7873912-7873934 | CCCTAGCACGAGACGGTATTTTG | 0: 1 1: 0 2: 0 3: 0 4: 37 |
||
| Right | 1003640843 | 6:7873946-7873968 | CTTCACAAGCAGAATGAGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1003640843 | Original CRISPR | CTTCACAAGCAGAATGAGGT TGG | Intronic | ||
| No off target data available for this crispr | |||||