ID: 1003640843

View in Genome Browser
Species Human (GRCh38)
Location 6:7873946-7873968
Sequence CTTCACAAGCAGAATGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003640839_1003640843 10 Left 1003640839 6:7873913-7873935 CCTAGCACGAGACGGTATTTTGG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG No data
1003640838_1003640843 11 Left 1003640838 6:7873912-7873934 CCCTAGCACGAGACGGTATTTTG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003640843 Original CRISPR CTTCACAAGCAGAATGAGGT TGG Intronic
No off target data available for this crispr