ID: 1003642731

View in Genome Browser
Species Human (GRCh38)
Location 6:7888972-7888994
Sequence CTGCATGTTCATATTTAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 192}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003642724_1003642731 19 Left 1003642724 6:7888930-7888952 CCCGGGTCAGAGCTCCCAGATGT 0: 1
1: 0
2: 5
3: 81
4: 366
Right 1003642731 6:7888972-7888994 CTGCATGTTCATATTTAGACGGG 0: 1
1: 0
2: 2
3: 26
4: 192
1003642723_1003642731 27 Left 1003642723 6:7888922-7888944 CCTGCTTGCCCGGGTCAGAGCTC 0: 1
1: 0
2: 0
3: 15
4: 474
Right 1003642731 6:7888972-7888994 CTGCATGTTCATATTTAGACGGG 0: 1
1: 0
2: 2
3: 26
4: 192
1003642729_1003642731 4 Left 1003642729 6:7888945-7888967 CCAGATGTCTTAGCGGTGGTGCA 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1003642731 6:7888972-7888994 CTGCATGTTCATATTTAGACGGG 0: 1
1: 0
2: 2
3: 26
4: 192
1003642722_1003642731 28 Left 1003642722 6:7888921-7888943 CCCTGCTTGCCCGGGTCAGAGCT 0: 1
1: 0
2: 0
3: 17
4: 220
Right 1003642731 6:7888972-7888994 CTGCATGTTCATATTTAGACGGG 0: 1
1: 0
2: 2
3: 26
4: 192
1003642728_1003642731 5 Left 1003642728 6:7888944-7888966 CCCAGATGTCTTAGCGGTGGTGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1003642731 6:7888972-7888994 CTGCATGTTCATATTTAGACGGG 0: 1
1: 0
2: 2
3: 26
4: 192
1003642725_1003642731 18 Left 1003642725 6:7888931-7888953 CCGGGTCAGAGCTCCCAGATGTC 0: 1
1: 0
2: 3
3: 24
4: 287
Right 1003642731 6:7888972-7888994 CTGCATGTTCATATTTAGACGGG 0: 1
1: 0
2: 2
3: 26
4: 192
1003642721_1003642731 29 Left 1003642721 6:7888920-7888942 CCCCTGCTTGCCCGGGTCAGAGC 0: 1
1: 0
2: 4
3: 13
4: 192
Right 1003642731 6:7888972-7888994 CTGCATGTTCATATTTAGACGGG 0: 1
1: 0
2: 2
3: 26
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003642731 Original CRISPR CTGCATGTTCATATTTAGAC GGG Intronic
903878299 1:26491289-26491311 CTGCTTGTTCGTTTTGAGACGGG + Intergenic
905267684 1:36765986-36766008 CTGCATGGTCAGATTTACATGGG + Intergenic
906772242 1:48495509-48495531 CTGTGTGTTCTTATATAGACAGG + Intergenic
907027711 1:51137966-51137988 CTGCATGTTCTCATTTATATGGG + Intronic
908021544 1:59903440-59903462 CTGCATGTTCTTACTTATAATGG + Intronic
908250598 1:62262777-62262799 CTGCATGTTCTCATTTAAATGGG + Intronic
909340442 1:74525682-74525704 CTCCATGGTCATATTTATATTGG - Intronic
910751570 1:90636824-90636846 CTGAATATTCCTATTTACACTGG + Intergenic
911272828 1:95824608-95824630 CTGCCTATTCACATTTATACTGG + Intergenic
912098960 1:106182354-106182376 CTCCATGTTAATATTTAGGTTGG - Intergenic
914672205 1:149879467-149879489 CTGCATTTTCATATGAAGCCTGG - Intronic
918784151 1:188743243-188743265 CTGCATGTTCTCATTTAGACTGG - Intergenic
919273939 1:195387216-195387238 CACCATGTTCATATTTATATAGG + Intergenic
920036287 1:203067894-203067916 CTGCATCTTCCTTTTCAGACTGG - Intronic
921126701 1:212184309-212184331 CTGCAGGTTGATAATTTGACTGG + Intergenic
921645363 1:217609274-217609296 CTGCTTGTACATCTTTAGAATGG - Intronic
922850124 1:228725603-228725625 CAGCATCTTCAGATCTAGACAGG + Intergenic
923109245 1:230877851-230877873 CTGAATGTTTACATTTAGACAGG + Intergenic
924015925 1:239722860-239722882 ATACATGTTCATATTTACCCTGG - Intronic
924705102 1:246494867-246494889 CTGCATGTTCAGTTTTAAACTGG - Intronic
924756928 1:246949656-246949678 CTGCATGTTCTTATTCTTACAGG + Intronic
1063507671 10:6615938-6615960 TTGTATGTTCATATTTACAACGG + Intergenic
1068461126 10:57330237-57330259 CTTCATGCCCATATATAGACAGG + Intergenic
1069415629 10:68198361-68198383 CTGCATTCTCATTTTTTGACCGG + Intronic
1071892439 10:90025344-90025366 CTGCATGTTTTCATTTAGAGAGG - Intergenic
1072186626 10:93046157-93046179 CTGTATCTTCACATTTAGCCCGG - Intronic
1076073347 10:127511592-127511614 CTGGATGTTCATAGTTACAATGG - Intergenic
1082607410 11:55258169-55258191 CTGCAAGTGGATATTTGGACCGG - Intergenic
1087145452 11:94806224-94806246 ATGCTTGTTCATGTTTAGACTGG - Intronic
1087565496 11:99851663-99851685 CAGTATGTTCAAATTTAGATAGG - Intronic
1088154439 11:106786039-106786061 GTGCATGTGCACATTTGGACTGG - Intronic
1095035861 12:37370122-37370144 CTGCAAGTGCATATTTGGAGCGG - Intergenic
1097733671 12:63157286-63157308 CTTGATGATCAAATTTAGACAGG - Intergenic
1098176172 12:67793772-67793794 CTGCATGTTCTCATTTATAATGG + Intergenic
1103603487 12:122069482-122069504 CTGGATGTAAATATTTACACTGG + Intergenic
1105434966 13:20368519-20368541 GTGCATGTTCATGTTTCGCCTGG + Intergenic
1106553629 13:30791922-30791944 CTGCATGGTCAGATGCAGACAGG - Intergenic
1107726469 13:43304608-43304630 CTGCATGTTTATTTTAAAACAGG - Intronic
1109163703 13:59007688-59007710 CTCCATGTTACTATTTAGATGGG + Intergenic
1109818005 13:67612959-67612981 CTTAATGTTCATATTTTGAGAGG - Intergenic
1109868212 13:68294830-68294852 CTTCATGATCATATTTAAAGTGG + Intergenic
1110003855 13:70240158-70240180 CTGCAGGTGCATATTTTTACAGG + Intergenic
1111458320 13:88512304-88512326 ATGCATGTTCAGAATTAGATAGG + Intergenic
1111583551 13:90255076-90255098 CTGAATGTTCAGATGTAAACTGG + Intergenic
1112958447 13:105090943-105090965 CCACATGTTCTTATTTAGAAGGG - Intergenic
1113925210 13:113938106-113938128 CTGCATGTTCATCTTGTGAAAGG - Intergenic
1114489900 14:23093868-23093890 ATGCATGATCAGATTTAGAAGGG - Intronic
1115785377 14:36819912-36819934 CTGCATATTCATATAAAGATAGG - Intronic
1116159110 14:41245003-41245025 CTGCATGTTCTTATTTGTAAGGG + Intergenic
1117258355 14:54003285-54003307 CTGCAAGGCCATATTTAGAATGG + Intergenic
1118409710 14:65466159-65466181 CTTCATCTTTATATTTAGAGTGG + Intronic
1118633683 14:67728364-67728386 CTGTCTTTTCATATTTAGAGTGG - Intronic
1121412883 14:93760057-93760079 CTGCCTGACCATATTTAGACAGG + Intronic
1122146884 14:99696001-99696023 CTGCATTTTTATATTTAAAATGG + Intronic
1126324474 15:47461855-47461877 TTGTATATTCATATTTATACTGG + Intronic
1126948587 15:53853250-53853272 CTGCATGTTCTCATTTATAAGGG - Intergenic
1128430296 15:67587057-67587079 ATGAATGTTTAGATTTAGACTGG + Intronic
1130792575 15:87171180-87171202 CTGCATTTAAATATTTAGGCTGG + Intergenic
1133541801 16:6762991-6763013 TTGCATGTTCCTATTTGCACTGG - Intronic
1133656434 16:7869232-7869254 CTCAATGTTCATCTTTAAACTGG - Intergenic
1134367557 16:13593416-13593438 CTGAATTATCATTTTTAGACAGG + Intergenic
1139553816 16:67693201-67693223 CTGCATCTGCATATTTAGCCAGG + Intronic
1141517716 16:84557456-84557478 CTGCATTTTCATAAATATACAGG + Intergenic
1145685970 17:26664382-26664404 ATGCAAGTGGATATTTAGACGGG + Intergenic
1147630535 17:41927839-41927861 CTCAATATTTATATTTAGACAGG + Intronic
1150667421 17:67154929-67154951 CAGTAAGTTGATATTTAGACAGG - Intronic
1151266491 17:72960179-72960201 CAGCATGGTCATATTTATCCAGG + Intronic
1152632526 17:81416993-81417015 CTGCATGTCCACAGCTAGACTGG + Intronic
1153801446 18:8674251-8674273 CTGCCTGTTCAAACTTGGACTGG - Intergenic
1153924710 18:9825855-9825877 CTGCATGTTCTTACTTATAAGGG + Intronic
1155458790 18:26052634-26052656 CTGCATACTCATATTTGGTCTGG + Exonic
1157129575 18:44993714-44993736 CTGCTTGTTGAAATTTTGACTGG - Intronic
1160325443 18:77942806-77942828 CTGTATTTTCATATTTAAAGAGG - Intergenic
1162841866 19:13362665-13362687 CTGAATTTTCATATTTAGGGGGG + Intronic
1164348522 19:27300061-27300083 CTGCATGTGGATATTTGGAATGG + Intergenic
929611018 2:43270681-43270703 CTGCATATTCACATTTAAAATGG + Intronic
930495413 2:52135382-52135404 CAGTTTGTTCATATTTAAACAGG - Intergenic
931122813 2:59239133-59239155 CTGCTTGTTAATGTTTTGACTGG + Intergenic
933489585 2:82968553-82968575 ATGCATGCATATATTTAGACTGG + Intergenic
933692266 2:85188516-85188538 CTGTATGTCCATATTTTTACAGG - Intronic
934649176 2:96079958-96079980 ATGCATCTTTATATTTAGAATGG + Intergenic
935640730 2:105287579-105287601 CTGCATCTTCATCTTTATACAGG + Intronic
939892502 2:147754200-147754222 ATGCATGTTCATTCTGAGACGGG + Intergenic
940837019 2:158533493-158533515 CTGCATGTTCCGATTCTGACTGG - Intronic
941066577 2:160910000-160910022 TTGCATGTAAATATTTAGACTGG + Intergenic
944486046 2:200206817-200206839 CTGCATGTTCTTATTTGTAGTGG + Intergenic
945599591 2:211843319-211843341 ACGCATCTTCTTATTTAGACTGG - Intronic
945687341 2:212987385-212987407 CAGAAAGTTCATATTTAGATTGG - Intergenic
945818750 2:214637118-214637140 CTGCAAGTTCAGATGTTGACGGG - Intergenic
947049132 2:226022337-226022359 ATACAGGTTCATATTTTGACAGG + Intergenic
948737402 2:240017901-240017923 CGGCATTTTCATCTGTAGACTGG - Intronic
948796809 2:240407938-240407960 CTGAATATTCAGATTCAGACAGG + Intergenic
1171829994 20:29983923-29983945 CTGCAAGTTGATATTTGGAGCGG + Intergenic
1171830349 20:29990756-29990778 CTGCAAGTTGATATTTGGAGCGG + Intergenic
1171830559 20:29994855-29994877 CTGCAAGTTGATATTTGGAGCGG + Intergenic
1171830632 20:29996223-29996245 CTGCAAGTTGATATTTGGAGCGG + Intergenic
1172035654 20:32009088-32009110 CTGCCTGTCCAACTTTAGACTGG + Intergenic
1173103846 20:40112788-40112810 CTGCATGTCCAGATTTACAAAGG - Intergenic
1178925854 21:36774359-36774381 CTCCATGTTCATATCAACACTGG - Intronic
1179094051 21:38296164-38296186 ATGCAGGTAGATATTTAGACCGG + Intronic
1184899779 22:47438388-47438410 CTGCATGTTCAGTCTTAGACTGG - Intergenic
951991165 3:28677597-28677619 CTGCTTGGTCATATTGAGACGGG + Intergenic
954997972 3:54899410-54899432 CTTCATGGTTATATTTAGACAGG + Intronic
955709170 3:61760822-61760844 CTGCATGTTCTTACTTAAAGAGG - Intronic
956794827 3:72708494-72708516 ATGCATATTTATAATTAGACTGG - Intergenic
956896739 3:73668391-73668413 CTGCATTTTAATATTTATAATGG + Intergenic
957666566 3:83238165-83238187 ATGCATTTTCATGTTTAGACTGG - Intergenic
958219940 3:90655912-90655934 TTGCAAGTGCATATTTAGAGCGG - Intergenic
959793950 3:110399429-110399451 CTGCATTTTCATTTTTTTACTGG + Intergenic
963421837 3:145070970-145070992 CAGCCTGTTCAGATTTGGACCGG + Intergenic
963488274 3:145964950-145964972 CTGGAAGTTTATATTTAGAAAGG - Intergenic
963572128 3:147010713-147010735 CTGCTTGTTGATTTTTAGAATGG - Intergenic
963675210 3:148302070-148302092 CTGCATGTTCTTACTTATAAGGG - Intergenic
963986847 3:151606132-151606154 TTGCACGTGCATGTTTAGACAGG - Intergenic
970849679 4:20586212-20586234 ATTCATGTTAATATTTAGTCAGG + Intronic
971089741 4:23327456-23327478 CGGCATGTACATATATACACAGG - Intergenic
972592492 4:40500980-40501002 CTGCAAGTCAATATTTAAACTGG + Intronic
973030228 4:45328670-45328692 CTCCTTGATCAAATTTAGACAGG + Intergenic
973460749 4:50641901-50641923 CTGCAAGTTGATATTTCGATAGG + Intergenic
973472748 4:50839637-50839659 CTGCAAGTTGATATTTAGATAGG + Intergenic
973506587 4:51397909-51397931 CTGCAAGTTGATATTTCGATAGG + Intergenic
975727661 4:77307674-77307696 CTGCATTTTCAAGTTTAGTCTGG - Intronic
976858050 4:89628129-89628151 CTTCAAGTTCATATTTTGTCTGG + Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
980723174 4:136723360-136723382 CTGCATGTTCAAATCTAGGCAGG - Intergenic
983657804 4:170100536-170100558 CTACATGTGCATATATATACAGG + Intergenic
987812914 5:22861693-22861715 ATGCATGATTATATTTAGACAGG - Intergenic
989858721 5:46336840-46336862 CTGCAAGTGTATATTTGGACAGG - Intergenic
989859328 5:46347051-46347073 CTGCAAGTGGATATTTAGACTGG - Intergenic
989859541 5:46351151-46351173 CTGCAAGTGGATATTTGGACAGG - Intergenic
989859740 5:46355069-46355091 CTGCAAGTGGATATGTAGACCGG - Intergenic
989859966 5:46359315-46359337 CTGCAAGTGCATATTTTGACCGG - Intergenic
989860095 5:46361668-46361690 CTGCAAGTAGATATTTAAACTGG - Intergenic
989860118 5:46362178-46362200 CTGCAAGTGGATATTTGGACTGG - Intergenic
989862857 5:46403411-46403433 CTGCAGGTGGATATTTGGACCGG + Intergenic
989862897 5:46404269-46404291 CTGCAAGTCGATATTTGGACAGG + Intergenic
989863064 5:46407680-46407702 CTGCAAGTGGATATTTGGACTGG + Intergenic
989863116 5:46408533-46408555 CTACAAGTGGATATTTAGACTGG + Intergenic
989863328 5:46412451-46412473 CTGCAAGTGGATATTTAGACCGG + Intergenic
989863386 5:46413474-46413496 CCGCAAGTGGATATTTAGACCGG + Intergenic
989863436 5:46414498-46414520 CTGCAAGTGGATATTTAGAGCGG + Intergenic
989863531 5:46416197-46416219 CTGCAAGTTTATATTTGGACCGG + Intergenic
989896031 5:47084841-47084863 CTGCAAGTGGATATTTTGACAGG - Intergenic
989896428 5:47092472-47092494 CTGCAGGTGGATATTTAGAGTGG - Intergenic
992284116 5:75215056-75215078 CTGCCTGTTGACCTTTAGACTGG - Intronic
993844600 5:92924983-92925005 CTGCATGTACATCTTTACAAAGG - Intergenic
994185409 5:96809691-96809713 CTGCATGTTCAGAATTTGACAGG + Intergenic
995805729 5:116050321-116050343 CTGCATGTTCTTACTTAGGTGGG - Intronic
996480034 5:123965445-123965467 CTGCATGTTATTTTTTAAACAGG + Intergenic
997778996 5:136638354-136638376 CTGCTTTTTCATCTGTAGACTGG - Intergenic
998578386 5:143343150-143343172 CTGCCTTTTCATATTTAGAATGG + Intronic
1000016592 5:157283182-157283204 CTGTTTGTTCATCTATAGACTGG + Intronic
1000737440 5:164922867-164922889 CTGCATGTTCTTACTTATAAAGG - Intergenic
1202771557 5_GL000208v1_random:5468-5490 CTGCAAGTGGATATTTTGACAGG - Intergenic
1202772106 5_GL000208v1_random:15830-15852 CTGCAGGTGGATATTTAGAGTGG - Intergenic
1003642731 6:7888972-7888994 CTGCATGTTCATATTTAGACGGG + Intronic
1006211484 6:32399154-32399176 CTGCATGTTCACACTTATAAGGG - Intronic
1007094295 6:39203864-39203886 CTGCATACTCCTTTTTAGACAGG - Intronic
1008133281 6:47742387-47742409 ATGCATGTTTATATATATACAGG - Intergenic
1010551525 6:77228833-77228855 TAACATGTTCATATCTAGACAGG - Intergenic
1010743433 6:79534794-79534816 CTGCATCCTCTTATTGAGACAGG - Intronic
1010933897 6:81837166-81837188 CTGCATGTAGATATTTATACTGG + Intergenic
1014645127 6:123963814-123963836 TAGCATGTTCATTTTTAGACAGG + Intronic
1015126540 6:129761428-129761450 CTGCCAGTTCAAACTTAGACTGG - Intergenic
1016237622 6:141887396-141887418 CTCCATGTTCACATTTATGCTGG - Intergenic
1018133634 6:160756651-160756673 CTTCATGTTCATATATTGGCTGG + Intergenic
1018896982 6:168026284-168026306 CAGCGTATTCATATTGAGACAGG - Intronic
1019535220 7:1525728-1525750 CTGCTTGTTCATATGTAAAAGGG - Intergenic
1020734233 7:11926711-11926733 ATACATGTACATATTTAAACAGG - Intergenic
1024305713 7:47928032-47928054 ATGCATATCCATATCTAGACGGG - Intronic
1024903960 7:54354640-54354662 CTGGATGCTCATATGTAGAGAGG + Intergenic
1024915115 7:54490399-54490421 CTGCATGTTCACACTTAAAGTGG - Intergenic
1026426480 7:70299550-70299572 CTGCATTTTCATTTCTAGATTGG + Intronic
1027720699 7:81737993-81738015 CTGCATGTTCTTACTTAAAGTGG + Intronic
1029235922 7:99118866-99118888 CTGCATTGTTATTTTTAGACAGG + Intronic
1039393174 8:37199006-37199028 CTGAAACTTAATATTTAGACTGG - Intergenic
1039697181 8:39925521-39925543 CTGCATCTTCATTTTTAAAATGG - Intronic
1042224435 8:66504437-66504459 CTGCATGTTTATACATAGGCAGG - Intronic
1044719121 8:95128831-95128853 CTGCATGTTCAAATTTATACTGG + Intergenic
1047128794 8:121994529-121994551 CTGCATTTGCAGATTTAGAGTGG + Intergenic
1048483313 8:134822740-134822762 CTACATGTGCATATTTTCACAGG + Intergenic
1050541228 9:6672036-6672058 CTACATGTCCATATTGAGTCTGG - Intergenic
1050886619 9:10774734-10774756 CTGTATGTTCTATTTTAGACTGG + Intergenic
1051287172 9:15509936-15509958 CTGGATTTTCATAATTACACGGG + Intronic
1052526542 9:29626480-29626502 CTGCATCTCCATTTCTAGACTGG - Intergenic
1052547210 9:29894771-29894793 CTGGATTTTAATATTTAGAAAGG - Intergenic
1053950413 9:43369446-43369468 CTGCAAGTTGATATTTAGATAGG + Intergenic
1053966992 9:43662705-43662727 CTGCAAGTTGATATTTAGATAGG + Intergenic
1054047030 9:45043994-45044016 CTGCAAGTTGATACTTAGATAGG + Intergenic
1054063997 9:45332590-45332612 CTGCAAGTTGATATTTATATAGG + Intergenic
1054084969 9:60681002-60681024 CTGCAAGTTGATACTTAGATAGG - Intergenic
1054421501 9:64936480-64936502 CTGCATGTGGATATTTGGATCGG + Intergenic
1054714590 9:68544695-68544717 CTGCATGTTCCCATTTATAGTGG - Intergenic
1055133151 9:72798600-72798622 CTGCATGTTCTTACTTATATGGG + Intronic
1055533394 9:77210653-77210675 CTGCATGCTCAGATTTTGAAGGG - Exonic
1055751931 9:79516008-79516030 CTGCATGAGCATATTTACAATGG - Intergenic
1056914358 9:90732077-90732099 CTGCAGGTTCATATTTTTTCTGG - Intergenic
1057226982 9:93297660-93297682 CTGTTTGTTCATATCTAAACGGG - Intronic
1058427896 9:104891600-104891622 CTGCATGATCAGAGTGAGACTGG + Intronic
1203418571 Un_KI270389v1:548-570 CTGCAAGTTGATACTTAGATAGG + Intergenic
1203419124 Un_KI270394v1:847-869 CTGCAAGTTGATACTTAGATAGG + Intergenic
1203593654 Un_KI270747v1:98674-98696 CTGCAAGTTGATATTTAGATAGG + Intergenic
1203593721 Un_KI270747v1:99862-99884 CTGCAAGTTGATATTTATATAGG + Intergenic
1203594459 Un_KI270747v1:112116-112138 CTGCAAGTTGATACTTAGATAGG + Intergenic
1203594758 Un_KI270747v1:117040-117062 CTGCAAGTTGATACTTAGATAGG + Intergenic
1203596338 Un_KI270747v1:143895-143917 CTGCAAGTTGATACTTAGATAGG + Intergenic
1187481932 X:19664694-19664716 CTGCATGTTGATATTGTGACAGG + Intronic
1187583455 X:20634388-20634410 ATGCATGTTCACCCTTAGACTGG + Intergenic
1188198699 X:27273000-27273022 TTACATGCTGATATTTAGACAGG - Intergenic
1188338584 X:28970931-28970953 CTACATGTGCTTTTTTAGACTGG - Intronic
1188824362 X:34812113-34812135 CTGCATATTCATGTTTATAATGG - Intergenic
1190910146 X:54764074-54764096 CTGCATCTTTATATTTAAAGTGG + Intronic
1191566035 X:62532529-62532551 CTACAGGTGCATATTTGGACAGG + Intergenic
1191569386 X:62589911-62589933 CTGCAAGTTGATATTTGGAGTGG + Intergenic
1194114498 X:89879558-89879580 CTGCGTCTTTATATTTAGAGAGG - Intergenic
1194802613 X:98291225-98291247 CTGAATTATCATTTTTAGACAGG + Intergenic
1196469298 X:116007750-116007772 GAGCATGTTCATATTTTGAGAGG + Intergenic
1197156181 X:123272616-123272638 CTCCAAGTGCACATTTAGACTGG + Intronic
1199220067 X:145307683-145307705 CTGCATTTTAATTTTTATACAGG + Intergenic
1199350990 X:146799659-146799681 CTGCATGTAAATATTTAAAAAGG + Intergenic
1200467239 Y:3534924-3534946 CTGCGTCTTTATATTTAGAGAGG - Intergenic