ID: 1003645156

View in Genome Browser
Species Human (GRCh38)
Location 6:7908952-7908974
Sequence ATTAACAGTTTCTCTTTGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 415}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003645156_1003645158 22 Left 1003645156 6:7908952-7908974 CCGAACAAAGAGAAACTGTTAAT 0: 1
1: 0
2: 2
3: 25
4: 415
Right 1003645158 6:7908997-7909019 CAAAGTAATTTCTAAACCATTGG 0: 1
1: 0
2: 6
3: 34
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003645156 Original CRISPR ATTAACAGTTTCTCTTTGTT CGG (reversed) Intronic
901713380 1:11133679-11133701 AGTAACAGTTTCTATTTCCTAGG - Intronic
903102258 1:21040961-21040983 TTTAACACTTTCCCTTTTTTTGG + Intronic
903199974 1:21728349-21728371 ATTAACAGCTTCCCATTTTTAGG + Intronic
904502549 1:30924058-30924080 ATTATTATTTTCTCTTTTTTTGG + Intergenic
904625932 1:31802178-31802200 ATTAACCATTTCCCTTTGATGGG - Intronic
905436635 1:37960415-37960437 AGTATCAGTTTCTCTGTTTTCGG - Intronic
907072367 1:51548230-51548252 AATTACAATTTCTTTTTGTTTGG + Intergenic
907235739 1:53045316-53045338 AATAACATTTACTCTTTTTTAGG + Intronic
908290935 1:62666419-62666441 ATTAATAGATTTTCTTTTTTGGG - Intronic
908376628 1:63548772-63548794 ATTAACTTTTTCTTATTGTTAGG + Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909929723 1:81482240-81482262 ATTCAAACTTTCTGTTTGTTTGG - Intronic
910069606 1:83195817-83195839 ATTAACAGTTTACATTTCTTGGG + Intergenic
910248492 1:85168239-85168261 ATTAACAGTTACTCCTCCTTTGG - Intronic
910537473 1:88314792-88314814 ATTAACTTTTTCTGTTAGTTTGG + Intergenic
911765225 1:101666333-101666355 GTTAACAGGTTCTCTGAGTTAGG + Intergenic
911899980 1:103491205-103491227 GTTATCATTTTCTCTTTTTTTGG + Intergenic
913594851 1:120365517-120365539 AATTACAGTTTTTGTTTGTTCGG + Intergenic
914092416 1:144513469-144513491 AATTACAGTTTTTGTTTGTTCGG - Intergenic
914306115 1:146420402-146420424 AATTACAGTTTTTGTTTGTTCGG + Intergenic
914595937 1:149152407-149152429 AATTACAGTTTTTGTTTGTTCGG - Intergenic
915837046 1:159185629-159185651 ATCAACAGTTTCTATATGTCAGG - Intronic
917257666 1:173132913-173132935 ATTAAGAGTCACACTTTGTTAGG + Intergenic
917513937 1:175691430-175691452 AATAACAGTATCTCCTTTTTAGG - Intronic
918013471 1:180609646-180609668 GATACCAGTTTCTCTTAGTTTGG + Intergenic
918913099 1:190598620-190598642 GAGAACAGTTTCTCTCTGTTTGG - Intergenic
919127769 1:193416898-193416920 ATGGATAGTTTCTCATTGTTAGG + Intergenic
919614802 1:199793023-199793045 ATTTACCATTTCTTTTTGTTGGG + Intergenic
919719392 1:200815890-200815912 AATAACAGTTTGCCTTTCTTTGG + Intronic
920257747 1:204667606-204667628 ATTAAAAGTCTCTCTTTGCTGGG - Intronic
921949231 1:220911624-220911646 ATTAGCACTCTATCTTTGTTAGG + Intergenic
922504939 1:226121070-226121092 ATTATCAGCTTCTGCTTGTTGGG + Intergenic
922676705 1:227557681-227557703 AAGAACAGTTTTTCTTTTTTAGG - Intergenic
923260693 1:232265095-232265117 TTTAACAGTTTTCCTGTGTTTGG + Intergenic
1064147249 10:12835326-12835348 ATTCACAGTTTCCCTTCTTTTGG - Exonic
1064830480 10:19460313-19460335 GTTAACTGTTTCTTTATGTTTGG - Intronic
1064846601 10:19662049-19662071 ATTAACAGATGCTACTTGTTTGG - Intronic
1065322232 10:24520486-24520508 AGTAACACTTTCTATTTGCTAGG + Intronic
1065655858 10:27949326-27949348 ATTTATAGTTTCTGTTTATTTGG - Intronic
1066259843 10:33718911-33718933 TTTAACTGTTTCTCTTATTTTGG - Intergenic
1068613510 10:59086787-59086809 ATTCTCAGTATCTATTTGTTGGG - Intergenic
1069068539 10:63971767-63971789 ATTACCAGTTTTATTTTGTTTGG - Intergenic
1070468163 10:76746596-76746618 ATTATCAGTCTTTCTTTTTTTGG - Intergenic
1071176276 10:82930226-82930248 ATTCACAGTTTCCCCTTGTGTGG + Intronic
1071290260 10:84183961-84183983 ATTAACAATTTCTCTATTATAGG + Intronic
1071581808 10:86778577-86778599 ATTTATAATTTCTTTTTGTTCGG + Intronic
1071834073 10:89402248-89402270 AAAAACAGATTTTCTTTGTTAGG - Intronic
1072279953 10:93856679-93856701 ATTCACAGTTTCACTTTCTATGG + Intergenic
1072587273 10:96793680-96793702 ATGTACAGATTCTCTTTTTTTGG - Intergenic
1073895669 10:108153668-108153690 AATAACAGTATCACTTTGGTGGG + Intergenic
1074662964 10:115683304-115683326 AATGACAGTGTCTTTTTGTTTGG - Intronic
1074677864 10:115872760-115872782 ATTTACAGTTGCTCTTTCTCTGG - Intronic
1077948775 11:6931546-6931568 ATGAAAAGTTTATATTTGTTAGG - Intronic
1078891811 11:15564435-15564457 ATTTCCTGTTTCTCTGTGTTTGG + Intergenic
1079273916 11:19015650-19015672 ATTAACAGTGTTCCTATGTTGGG + Intergenic
1080184752 11:29468718-29468740 GTTTACATGTTCTCTTTGTTCGG + Intergenic
1080272371 11:30464390-30464412 GTTATCAATTTCTCTTTCTTGGG - Intronic
1080293654 11:30700390-30700412 ATTAACATTTCCTATTTCTTTGG + Intergenic
1080318420 11:30977342-30977364 ATTTACCGTTTCTATGTGTTGGG - Intronic
1081036494 11:38153365-38153387 ATTAATTGTTTCTATGTGTTGGG - Intergenic
1081089924 11:38851553-38851575 ATTAAGTGTTTCTTTTTGTGGGG + Intergenic
1081768842 11:45634153-45634175 AATAATATTTTCTCTTTGGTTGG - Intergenic
1082721292 11:56680007-56680029 ATACAGAGATTCTCTTTGTTTGG + Intergenic
1083977669 11:66136757-66136779 ATTAATAAGTTCTCTATGTTCGG + Intronic
1085548394 11:77343072-77343094 ATGAACAGTATCTCATTGTGAGG - Intronic
1086252720 11:84836566-84836588 TTTAACACTTTCTCTATGTAAGG + Intronic
1086484404 11:87282984-87283006 ATTAAATGTTTCTCTTTCTTGGG + Intronic
1086723966 11:90158664-90158686 AGTAACTGTTTCTCCTTGATAGG + Intronic
1087409107 11:97768047-97768069 ATTTACAGTTTCTAATTGTATGG + Intergenic
1088944696 11:114497921-114497943 ATAAACAGGTTTTCTTTTTTGGG + Intergenic
1089533699 11:119148589-119148611 ATTCACACTTTCTCTGAGTTAGG - Intergenic
1089950906 11:122525339-122525361 ATTAACAGTTTTTCCTGGATTGG - Intergenic
1090774890 11:129955202-129955224 TTTAAAAGTGTCTCTTTTTTTGG - Intronic
1092571252 12:9724229-9724251 ATAAACACTTTCACTTTTTTTGG + Intronic
1092951054 12:13503595-13503617 ATTATGAATTTCTCTTTGTCAGG - Intergenic
1093674606 12:21922893-21922915 ACTAACATTTTCTCTTGCTTTGG - Intronic
1094353163 12:29548624-29548646 ATTCACAGTTTCACATGGTTGGG - Intronic
1095042768 12:37461779-37461801 TCTAACTGTTTCTCTTTCTTGGG + Intergenic
1095819715 12:46464298-46464320 ATTCAGAGTTTCTTTTTATTTGG - Intergenic
1095886900 12:47197836-47197858 ATTATCTATTTCTCTTTGTGTGG - Intronic
1096107013 12:49002084-49002106 ATTATCAGCTTTTCTTAGTTGGG - Intergenic
1096989656 12:55789525-55789547 CGTGATAGTTTCTCTTTGTTTGG - Intronic
1098048391 12:66426519-66426541 ATGATAGGTTTCTCTTTGTTTGG + Intronic
1098376641 12:69822409-69822431 ATTGACAGTTTCTATCTGCTTGG - Exonic
1098513253 12:71343824-71343846 AAAAACACTTTCTCTTTTTTAGG + Intronic
1098631260 12:72724960-72724982 ATTCACAGTTGTTCTTGGTTGGG + Intergenic
1098693629 12:73523007-73523029 ATTGACATTTTCTATTTGATGGG - Intergenic
1098766604 12:74498146-74498168 ATGAACAATTTTTCTTGGTTAGG + Intergenic
1099280939 12:80645235-80645257 ATTAACAGGTGTACTTTGTTAGG - Intronic
1101526246 12:105534035-105534057 ATTCACAGTTTCTCATGGATTGG + Intergenic
1101944816 12:109128656-109128678 TTTAAAAGTTTTTCTTTATTTGG + Intronic
1102103957 12:110304273-110304295 CATAACATTTTCTCTCTGTTAGG + Intronic
1102840191 12:116111562-116111584 TTTAAAAGTTTCTTTTTATTTGG - Intronic
1102843955 12:116157752-116157774 AATAAAAGTTTGTCTTTGTGGGG - Intronic
1103084291 12:118050331-118050353 AATACCAGTTTTTCTTTCTTTGG - Intronic
1103257212 12:119552014-119552036 GCTAACAGCTTCTCTTTCTTCGG + Intergenic
1104412934 12:128574399-128574421 AATAACGGTTTCTCTATGGTAGG - Intronic
1105450872 13:20498811-20498833 AAAAACATTTTCTCTTTGATAGG - Intronic
1106070104 13:26402550-26402572 ATTAACTCTTTCTTTTGGTTAGG + Intronic
1106443318 13:29800565-29800587 ATTCACACTTTATCATTGTTAGG - Intronic
1106988794 13:35390323-35390345 TTTAACACTTTCTTTTTCTTTGG + Intronic
1107753586 13:43595270-43595292 ATTTACATTTTCTTTTTCTTTGG + Intronic
1108572414 13:51764682-51764704 AGTATCAGTTTCTTTTTCTTTGG + Exonic
1109001638 13:56812294-56812316 AGTCACAGTTTCTCTCTATTTGG + Intergenic
1109086840 13:57984792-57984814 TTTAACAGTTTTTTTTTTTTTGG - Intergenic
1109242216 13:59903181-59903203 AGTAACTGTATGTCTTTGTTAGG + Intronic
1109523948 13:63550245-63550267 ATTCACTGTTTTTGTTTGTTTGG + Intergenic
1109532527 13:63669158-63669180 AGTAACAGTTTCTTTTAGTGAGG + Intergenic
1111095838 13:83514412-83514434 ATCTACAGTTTTTTTTTGTTTGG - Intergenic
1111277750 13:85972818-85972840 ATTAAAGGTTTCCCTATGTTTGG - Intergenic
1111453512 13:88449791-88449813 AATAACAGGTTCTCTTAGTTTGG - Intergenic
1111716080 13:91880764-91880786 AGTAACATTTTTTGTTTGTTTGG + Intronic
1112024074 13:95396505-95396527 ATAAACAGTATCTATTGGTTGGG - Intergenic
1112748105 13:102551002-102551024 ATTAAATGTTTCTGTTTTTTAGG + Intergenic
1112865742 13:103895267-103895289 ATTAAGAGTTTCTCTTCCATTGG + Intergenic
1112911107 13:104484926-104484948 ATTAACAATTTTTTTTTTTTTGG - Intergenic
1114822100 14:26033089-26033111 ATGAACAGTTTTTCCTTGCTTGG - Intergenic
1114910959 14:27195461-27195483 TTTATCAGTTTCTATTTGTGTGG + Intergenic
1115450102 14:33538107-33538129 AATAAGAGTTTCTTTTTGGTTGG - Intronic
1116975967 14:51116368-51116390 ATTATTAGTTTCTCTTTTTTTGG - Intergenic
1118802432 14:69202938-69202960 AGTAACAGAATCTCATTGTTGGG - Intronic
1119958010 14:78821757-78821779 ATTATCAATTTCTTTTTGTAAGG - Intronic
1120006713 14:79366291-79366313 ATTTACTGTTTCTTTGTGTTAGG + Intronic
1120461778 14:84806175-84806197 ATTAACTTTTTCTCCTTGTGTGG + Intergenic
1120979047 14:90274733-90274755 ATTAATAGTAACTGTTTGTTAGG - Exonic
1121992187 14:98569059-98569081 ATTCTCATTTTTTCTTTGTTGGG + Intergenic
1122569539 14:102685974-102685996 ATTTACATTTTCTCTATATTAGG - Intronic
1123191695 14:106578271-106578293 ATTAATAGGTTATCTTTGTTTGG - Intergenic
1202941313 14_KI270725v1_random:149381-149403 TCTAACTGTTTCTCTTTCTTAGG + Intergenic
1123851831 15:24365329-24365351 ACTCACAGTTTCTCTTGGTCAGG - Intergenic
1123926301 15:25115048-25115070 TTGAACAGTTTCTCCTTTTTGGG + Intergenic
1124183145 15:27497138-27497160 ATTATTAGTTTTTCATTGTTAGG + Intronic
1125006984 15:34827892-34827914 ATTAACATTTTCTGTTTATCAGG - Intergenic
1125065886 15:35486081-35486103 ACTCACAGTTCCACTTTGTTGGG + Intronic
1125248318 15:37669589-37669611 ATTAGCATTTTCTCTCTATTAGG - Intergenic
1125290759 15:38143710-38143732 ATTAACAGTGTCTGTTCTTTGGG + Intergenic
1125483520 15:40096471-40096493 ATTATAAGTTGCTCTCTGTTTGG - Intronic
1125765036 15:42129330-42129352 ATTTTCATTTTCTCTTTTTTTGG + Intergenic
1126749865 15:51865654-51865676 ATTGACAGCATCTGTTTGTTGGG + Intronic
1127533715 15:59869752-59869774 AGCATCTGTTTCTCTTTGTTGGG + Intergenic
1127671953 15:61203772-61203794 TTTAAGATTTTCTCTTTCTTTGG - Intronic
1128926655 15:71662309-71662331 TTGAACAGTTTTTCTTTGATTGG - Intronic
1129080951 15:73040290-73040312 AATAATAGTTTCTCATTCTTTGG - Intergenic
1129302868 15:74636275-74636297 ATTAACAGTATCTATTTCATAGG + Intronic
1131029119 15:89171517-89171539 ATTTAAATTTTCTGTTTGTTAGG + Intronic
1134876898 16:17708546-17708568 AGTAACAGTTTCTTTCTGCTTGG - Intergenic
1135845770 16:25917092-25917114 AGTAACAATTTCTCTATGTAGGG + Intronic
1135938280 16:26799295-26799317 ATCATCAGTTTCTCTTCTTTTGG - Intergenic
1136855880 16:33656990-33657012 CTTAAAACTTACTCTTTGTTTGG + Intergenic
1137054729 16:35738968-35738990 ATTAACAGTTACTATTTCTTAGG - Intergenic
1137851349 16:51748366-51748388 ATTGACAGTTTCTTTTGGTCTGG + Intergenic
1138002060 16:53291096-53291118 TTTAATATCTTCTCTTTGTTTGG - Intronic
1139736842 16:68997576-68997598 ATTACCATTTTCTTTTTGGTGGG + Intronic
1140625303 16:76787066-76787088 ATTAATAGTTTCTATTAGTATGG + Intergenic
1203117465 16_KI270728v1_random:1505469-1505491 CTTAAAACTTACTCTTTGTTTGG + Intergenic
1145715805 17:27019788-27019810 ATTAAAACTTTGTCTTGGTTGGG - Intergenic
1146135233 17:30314279-30314301 ATTATCACATTCTCTTTCTTGGG - Intergenic
1146959674 17:36963140-36963162 ATAAACAGTTTCTCTCTCCTTGG - Intronic
1148190484 17:45675270-45675292 AATAACAGTTTCTCTAGGTGTGG - Intergenic
1149034188 17:52115796-52115818 ATTAAAAGTTTCTCTCAGCTGGG + Intronic
1149167028 17:53764387-53764409 ATTATCACTTTATATTTGTTAGG + Intergenic
1149430267 17:56592155-56592177 AGAAGCAGTTTCTCTTTGATGGG - Intergenic
1149609722 17:57951235-57951257 ATGAACACTTCCTCTTTGTCTGG + Intronic
1152871998 17:82759657-82759679 ACTATCAGTTTCTTTGTGTTTGG + Intronic
1154329676 18:13419552-13419574 ATTAACAGTCTCTATTTGTGTGG - Intronic
1154935130 18:21047085-21047107 ATTAACAGTATTTCTTTATGGGG - Intronic
1155823416 18:30407853-30407875 ATTAGCAATTTCAATTTGTTTGG - Intergenic
1155827928 18:30472265-30472287 AATAACTGTGTCTCCTTGTTTGG - Intergenic
1155918417 18:31578480-31578502 GTTCACAATTTCTCTTTCTTGGG - Intergenic
1156031847 18:32722153-32722175 ATTCACAGTTTCACATTGCTTGG - Intronic
1156192807 18:34739246-34739268 ATTATCATTTTCTTTTTGTTTGG + Intronic
1157244187 18:46039096-46039118 ATGAACAGGTTCTATTTGTAAGG - Intronic
1159932444 18:74327601-74327623 ATTACAAGTTTGTCCTTGTTTGG + Intronic
1163472980 19:17508191-17508213 ATTCAAAGTTTCTCTTTCTGAGG - Intergenic
1165712692 19:38023480-38023502 CTTATCAGCTTTTCTTTGTTGGG + Intronic
1166421936 19:42643434-42643456 ATTAAAAGTTTTCCTTTTTTAGG + Intronic
1168546764 19:57258815-57258837 ATTAACATTTTCTTTCTGTTTGG + Intergenic
925603545 2:5634863-5634885 AATTACAGTTTTTGTTTGTTCGG + Intergenic
925889025 2:8418786-8418808 TTTAACAGTCTCTGTATGTTAGG - Intergenic
926179719 2:10630978-10631000 AGCAACATATTCTCTTTGTTTGG - Intronic
926425183 2:12733362-12733384 TTTAAAAGTTTTTCTTTCTTTGG + Intronic
928944388 2:36759646-36759668 ACTCACAGTTTCTCTTTGTGTGG - Intronic
929306140 2:40364603-40364625 ATAAACAGATTCCTTTTGTTCGG + Intronic
929497444 2:42458425-42458447 ATTCACATTCTCTCTTTATTGGG + Intronic
929988483 2:46763115-46763137 ATGAACTCTTTCTCTTTGTAAGG - Exonic
932949755 2:76279158-76279180 CTTAAAAGTTTCTCTTTCTGAGG - Intergenic
933122926 2:78565044-78565066 TTTAAAATTTTCTCTTTGTATGG - Intergenic
933322033 2:80788522-80788544 CTCAACAGTTTCTGGTTGTTTGG + Intergenic
933389629 2:81653482-81653504 TTTATTAGTTTCTCTTTTTTCGG + Intergenic
933573722 2:84042900-84042922 ATTAAAAGTTTGTCTTTGTTTGG - Intergenic
934475831 2:94592781-94592803 ATTAACAGTTTTTCTTCCTAAGG - Intronic
934789330 2:97045111-97045133 ATTGAGATTTTCTCTTTGTCTGG - Intergenic
934817149 2:97337430-97337452 ATTGAGATTTTCTCTTTGTCTGG + Intergenic
934820547 2:97371054-97371076 ATTGAGATTTTCTCTTTGTCTGG - Intergenic
935511256 2:103977803-103977825 ATAAATAATTTCTCCTTGTTTGG - Intergenic
936562690 2:113555522-113555544 AATAACATTTTATCTTTCTTTGG + Intergenic
936848197 2:116863509-116863531 ATCAACACTTTCTCTTTCCTGGG + Intergenic
936939115 2:117865015-117865037 ATTCACAGTTTCTGTGGGTTGGG + Intergenic
937102357 2:119281559-119281581 AAAAACAGTTTCTCTTTTTAAGG + Intergenic
937861428 2:126714479-126714501 CTTGCCAGCTTCTCTTTGTTAGG - Intergenic
938384402 2:130854097-130854119 ATTTACCGTTTCTCTTTTATTGG - Intronic
938395289 2:130941655-130941677 CTTAACATTTTCTCTTTCTCTGG - Intronic
938963786 2:136367338-136367360 ATTAACAGTTTTTTTTTTTCTGG + Intergenic
939143968 2:138390169-138390191 ATTAACAACTTCTATATGTTAGG - Intergenic
939285053 2:140118380-140118402 ATTAACAGTTTCTCTTCATTCGG + Intergenic
939672341 2:145028282-145028304 CTTAACTCTTTCTCTTTGCTGGG - Intergenic
939959171 2:148550988-148551010 TTTAAAAGTTTATTTTTGTTAGG - Intergenic
940797786 2:158098753-158098775 ATTAACAGCATCTCTGTCTTTGG - Intronic
941078043 2:161028761-161028783 TTTCTTAGTTTCTCTTTGTTGGG - Intergenic
941504495 2:166325015-166325037 ATTAACAGTTTATATTAGTATGG - Intronic
941698120 2:168575312-168575334 ACTCACAGTTTCTCTTGGCTTGG + Intronic
941899980 2:170669053-170669075 ATTAACAGTGTCTTTATTTTTGG + Intergenic
942037952 2:172029538-172029560 ATTGACAGTTTCTCTTAGTCAGG - Intronic
942074535 2:172344454-172344476 ATTGTCAGTTTCTCTCTGTATGG + Intergenic
942523614 2:176830044-176830066 AATAACACTTTCTCTTTAATAGG - Intergenic
942800181 2:179865918-179865940 ATTAACAATTTCTCCTTCATAGG - Intergenic
943122656 2:183756255-183756277 AAAAACATTCTCTCTTTGTTTGG - Intergenic
943709798 2:191078693-191078715 ATGAGCAGTTTCTCTTTTTCTGG - Intronic
943902630 2:193460354-193460376 CTTAACAGTTTCTCTTTTCCAGG + Intergenic
944048830 2:195443243-195443265 ATTAATAATTTCTATGTGTTGGG - Intergenic
944572581 2:201059478-201059500 ATTTACATTTGCTCTTTGGTTGG - Intronic
944783551 2:203044494-203044516 ATTACCAGTGTCTCTTTTCTTGG + Intronic
945009033 2:205442128-205442150 ATAAACAGTCCCTCTGTGTTGGG - Intronic
945167259 2:206959237-206959259 TTTATGAGTTTCTCTGTGTTTGG - Intronic
945491157 2:210456991-210457013 ATTAAAACTTTCTTTTTGATAGG + Intronic
946922762 2:224596701-224596723 AATAACAATTTCTTTTTCTTTGG - Intergenic
946965496 2:225033154-225033176 ATTAAAAGTTTCTTTATTTTGGG - Intronic
1169846289 20:9995770-9995792 ATTCACAGTTACTCTATTTTAGG - Intronic
1170182254 20:13545094-13545116 AATAACAGTTTCTATTTTTGTGG - Intronic
1172797873 20:37555317-37555339 ATTATCTTTTTCTCTTTTTTAGG + Intergenic
1173059654 20:39649374-39649396 ATTAACTGTATCTCTATTTTTGG + Intergenic
1173557669 20:43978159-43978181 ATTCACAGCTACTCTTTCTTTGG + Intronic
1173606277 20:44334181-44334203 GTTCCCAGTTTCTCTTTGATAGG - Intergenic
1174634110 20:51984118-51984140 AAGAACAGTTTCACTTTTTTAGG + Intergenic
1174824364 20:53755954-53755976 AATAACAGTTTCTCCTTCGTGGG + Intergenic
1175481657 20:59315482-59315504 ATGAACATGTTCTATTTGTTGGG + Intronic
1176581849 21:8537554-8537576 TCTAACTGTTTCTCTTTCTTAGG - Intergenic
1177226957 21:18269422-18269444 ATAAATAGTTTCTATTGGTTGGG + Exonic
1180264684 22:10514626-10514648 TCTAACTGTTTCTCTTTCTTAGG - Intergenic
1181329988 22:22083211-22083233 ATTAACAATTTATCTGTATTGGG - Intergenic
1184237151 22:43188890-43188912 ATTAAAAATTTCTTTTTGTAGGG - Intergenic
1184646963 22:45901331-45901353 ATTTACATTTTCTCTGTGTCAGG - Intergenic
1184920539 22:47602447-47602469 ATAAACATTTTCTCCTTGTTAGG - Intergenic
949308971 3:2674395-2674417 ATTTACTGTTTCTTTGTGTTGGG + Intronic
951828128 3:26891459-26891481 ATTCACATTTTATCTTTATTTGG + Intergenic
952725539 3:36580731-36580753 GTTAACAGTTTCTCCTAGTTTGG - Intergenic
953590839 3:44252007-44252029 AGAAACAGTTTATTTTTGTTTGG - Intronic
953900727 3:46841029-46841051 ATCCACAGTTTTTCTTTGTTGGG - Intergenic
955389554 3:58510942-58510964 ATTTACTGTTTCTTTTTCTTAGG + Intronic
956516772 3:70058334-70058356 GTTAAAAGTTTGTCTTAGTTTGG + Intergenic
957927824 3:86837942-86837964 ATTAACAGTTTTCCTCTTTTAGG + Intergenic
958587280 3:96105145-96105167 ATTACATGTTTCTTTTTGTTTGG + Intergenic
958753757 3:98225385-98225407 ATTAACCTTTTCTTTTTATTTGG - Intergenic
959135549 3:102414868-102414890 AATAACATTTTCTCTTTTTGTGG + Intronic
959800450 3:110487669-110487691 CTTTACAGTTTTTCTTTGTGAGG - Intergenic
960122532 3:113961506-113961528 ATTAACAGCGCCTCTTTGATAGG + Exonic
960828916 3:121823427-121823449 TTTAAGATGTTCTCTTTGTTTGG - Intronic
962300198 3:134233621-134233643 TTCAACAGTTTATCTTTCTTTGG + Intronic
962980635 3:140486090-140486112 CTTAAGAGTTTATCTTTGTGGGG - Intronic
963514873 3:146296113-146296135 ATGCACAGTTGTTCTTTGTTTGG + Intergenic
963561212 3:146867832-146867854 TTTAATACTTTCTTTTTGTTCGG - Intergenic
965027576 3:163322505-163322527 TTTAACTGTTTCTTTTTTTTTGG + Intergenic
965247121 3:166287023-166287045 GTTCACATTTTCTGTTTGTTAGG + Intergenic
965795926 3:172438536-172438558 ATTAACAGTGTTTCTCTGGTTGG - Intergenic
966031614 3:175355820-175355842 ATTAACAGTTTACTTTTGGTGGG + Intronic
966526806 3:180928443-180928465 ATTAACAGTGTGTATGTGTTTGG - Intronic
966555654 3:181257561-181257583 ATAAACACTTTCTCATTGTGAGG + Intergenic
966960771 3:184936441-184936463 ATTAGCAGTTTCTATTAGGTTGG + Intronic
967529853 3:190536086-190536108 ATTACCAGTTTTTGCTTGTTGGG + Intronic
967810009 3:193751115-193751137 AGTATCAGTTTCCTTTTGTTTGG + Intergenic
967900130 3:194441579-194441601 CTTGACAGTTTCTCTTTCTTAGG - Intronic
970218567 4:13784550-13784572 ATTACCAGTATCTCTTTCTTGGG + Intergenic
970508747 4:16759179-16759201 ATTAACCCTTTCATTTTGTTTGG - Exonic
971016069 4:22490238-22490260 ATAAACAGTTTTTCATTTTTAGG - Intronic
972663259 4:41138398-41138420 ATTTACAGTATTTCATTGTTGGG + Intronic
972941977 4:44206950-44206972 ATGAACATTTACTATTTGTTGGG + Intronic
973677878 4:53285189-53285211 ATTTACAGTTTAGCTTTCTTTGG + Intronic
974390655 4:61262596-61262618 ATTATCATTTTCTCTCTTTTGGG + Intronic
975399881 4:73923084-73923106 ATCTACAGTTTTTCTTTGTATGG + Intergenic
975528714 4:75378442-75378464 TTTCACAGCTTCTCTTGGTTAGG - Intergenic
975691410 4:76967733-76967755 ATTAATAGTTTTTTTTTTTTTGG + Intronic
976340230 4:83939010-83939032 ATTTACATTTTCTTTGTGTTTGG + Intergenic
977347442 4:95835042-95835064 AATGACAGTTTGTCTTTATTAGG - Intergenic
977890568 4:102306601-102306623 ATTAATATTTTCTCTCTGTATGG + Intronic
978152171 4:105450131-105450153 CTTAAGACTTTCTCTTTGTAAGG - Intronic
978280187 4:107002658-107002680 ATTTTCAGTTTCTCATTCTTAGG - Intronic
980214419 4:129833296-129833318 ATTAACTCTTTCTCTTCTTTTGG - Intergenic
980455416 4:133034460-133034482 ATTTACCATTTCTCTGTGTTAGG - Intergenic
980819926 4:138001386-138001408 ATTAATAGTTACTGTTTTTTAGG + Intergenic
980997965 4:139799272-139799294 GATAACTGTTTCTATTTGTTTGG + Intronic
981218700 4:142205202-142205224 GGTCATAGTTTCTCTTTGTTTGG + Intronic
981680071 4:147387458-147387480 TTTAAAAGTTACTCTTTCTTTGG - Intergenic
981912819 4:150001513-150001535 ATTCACAGTTTCTCATGGCTGGG + Intergenic
982425859 4:155259003-155259025 AGTTACTGTTTCTCTGTGTTGGG + Intergenic
983117867 4:163842115-163842137 TTTAATAGATTCTCTTTTTTAGG - Intronic
983277039 4:165630607-165630629 ATTGACAGTTTTTTTGTGTTTGG + Intergenic
983314845 4:166118270-166118292 TTTAAGAGTTTCTCTTGTTTAGG + Intergenic
983731080 4:170994155-170994177 TATAACAATTTCTCTTTCTTTGG - Intergenic
983826411 4:172267591-172267613 ATTCACAGTGTCTCTTTGGCAGG - Intronic
984615003 4:181887390-181887412 ATTTCCAATTTCTCTTTATTAGG + Intergenic
984645750 4:182218023-182218045 TTTAACACTTTCTATATGTTAGG + Intronic
986302360 5:6488032-6488054 ATTAACAGTTTTTTTTTCATAGG - Intronic
986963350 5:13241830-13241852 ATTTATAATTTCTCTTTGTATGG - Intergenic
987481358 5:18462700-18462722 ATTAACTGATCATCTTTGTTTGG - Intergenic
987571519 5:19668420-19668442 ATTAAAAGTTTCTCTGTTTTAGG + Intronic
988242138 5:28627168-28627190 AGTTACAGTTTTTCTTTCTTTGG - Intergenic
988632780 5:32948677-32948699 ATGCATAGTTTCTTTTTGTTAGG + Intergenic
989273892 5:39564741-39564763 ATTAACAGCTACTGTTTATTAGG + Intergenic
990727052 5:58767575-58767597 ATAAACATTTCCTCTTTTTTTGG + Intronic
992459833 5:76950532-76950554 GTTAATACTTTCTTTTTGTTAGG - Intergenic
992845186 5:80739673-80739695 ATTAACAGATTATCGTTCTTTGG + Intronic
993738089 5:91501763-91501785 ATTATCAATTTCTCTTTGAAAGG + Intergenic
993789009 5:92183841-92183863 ATTCACATTTTCTCTCTCTTTGG - Intergenic
994360707 5:98845886-98845908 ATTAAAAGTTTCTCTTGGCTTGG - Intergenic
994902207 5:105788810-105788832 ATTAACATTTTTTCTGTCTTTGG + Intergenic
995441226 5:112194563-112194585 ATTACCTGTTTCTCTTTTTCCGG + Exonic
995739956 5:115345991-115346013 ATTGTTAGTTTCTCTTTTTTTGG + Intergenic
995954230 5:117755456-117755478 ATTAACAGTTAATCTTTGCCAGG + Intergenic
996185740 5:120472744-120472766 ATCAACAGTTTCTTTCTCTTAGG + Intronic
996289811 5:121839476-121839498 ATTAAGAGATTCTGGTTGTTTGG - Intergenic
996387196 5:122921917-122921939 ACTAGCAGAATCTCTTTGTTTGG + Intronic
996660369 5:125995657-125995679 ATTTACAGTTCCTCATTATTGGG - Intergenic
997780854 5:136656792-136656814 GCTAAGAGTTTCTATTTGTTTGG - Intergenic
999173727 5:149617095-149617117 AGTCAAAGTTTCTCTTTGATAGG + Intronic
1000235170 5:159351706-159351728 TTTCACAGATTCTCTTTATTAGG + Intergenic
1000268323 5:159658971-159658993 TTTAACTCTTTCTCTTTGTCAGG - Intergenic
1000871523 5:166582996-166583018 TTCAATAGTTTCTTTTTGTTAGG + Intergenic
1000968482 5:167687988-167688010 ATTAACAGTTACTCTGTGCCAGG + Intronic
1000979439 5:167800775-167800797 ATCTCCAGTTTCTCTTTGTCTGG + Intronic
1001043993 5:168357084-168357106 ATCACAAGTTTCTCTTTGTTGGG + Intronic
1003169642 6:3711063-3711085 AGTAACAGTCTATCTTTGGTGGG + Intergenic
1003645156 6:7908952-7908974 ATTAACAGTTTCTCTTTGTTCGG - Intronic
1004363357 6:14990815-14990837 ATTAACAGAGTATTTTTGTTTGG - Intergenic
1004735429 6:18401376-18401398 ATTCACACTTCCTCATTGTTAGG + Intronic
1005664003 6:28031017-28031039 ATCCACAGTTTCTCTTTCTGCGG + Intergenic
1006818705 6:36873070-36873092 ATTGACAGTTACTCTGTGTGTGG + Intronic
1007939237 6:45761885-45761907 ATGACCAGTATCTTTTTGTTTGG - Intergenic
1007980449 6:46150474-46150496 ATTCACATTTTTTATTTGTTTGG - Intergenic
1008172781 6:48230315-48230337 ATTCACATCTTCTCTTTGATGGG + Intergenic
1008653916 6:53591598-53591620 ATTAATAATTTCTGTGTGTTGGG + Intronic
1009276086 6:61682246-61682268 ATCAAAAGTTTATCATTGTTGGG + Intronic
1009380821 6:63026862-63026884 ATTAACATTTTCTTTTTTGTTGG + Intergenic
1009885612 6:69620760-69620782 ATGAATGGTTTTTCTTTGTTTGG + Intergenic
1010070677 6:71740588-71740610 TCTAACAGTTTCTCTTTCTGTGG - Intergenic
1010910061 6:81542790-81542812 ATTTATAGTTTCTTTGTGTTAGG - Intronic
1011831539 6:91377982-91378004 ATTAACCGTTTTTCCTTATTTGG - Intergenic
1012173786 6:96052739-96052761 ATTAAAAGTTTCTAGTTTTTTGG + Intronic
1012444325 6:99292690-99292712 ACTAAGAGTTTCTATTTCTTTGG + Intronic
1013400610 6:109792492-109792514 ATTCACAGTTTCATTTTTTTGGG + Intronic
1013600186 6:111696709-111696731 ATTACCACTCTCTCTTTTTTTGG + Intronic
1014208572 6:118684001-118684023 GATAATATTTTCTCTTTGTTTGG + Intronic
1014348853 6:120313304-120313326 AGTAACAGTATCTGTTTCTTGGG + Intergenic
1014944176 6:127477168-127477190 CTTAACAGTTTCTCCTTGGATGG - Intronic
1015049445 6:128821519-128821541 ATTAATAATATCTCTTTGTCTGG - Intergenic
1016607621 6:145950307-145950329 ATTGACAGCCTCTCTTTGGTAGG + Exonic
1017185232 6:151593925-151593947 ATTCACAGTTTCTATTACTTTGG + Intronic
1018149401 6:160924409-160924431 AATATCACTGTCTCTTTGTTAGG + Intergenic
1020786577 7:12580866-12580888 ATCAACAGATTGTGTTTGTTTGG - Intronic
1021773997 7:24033897-24033919 AATTATAGTTCCTCTTTGTTTGG - Intergenic
1023232078 7:38043811-38043833 ATTTACCGTTTCTATGTGTTGGG + Intergenic
1023275147 7:38510775-38510797 ATCAACAGTTGCTTCTTGTTGGG - Intronic
1023683097 7:42708225-42708247 ATTTAATGTTTCTCTTTCTTAGG + Intergenic
1025564242 7:62411560-62411582 TTTAACAATTTCTGTTTGTAGGG - Intergenic
1026419245 7:70216345-70216367 ATTAACAGATTATAATTGTTTGG - Intronic
1027000418 7:74649279-74649301 ATTAACACTTTCTCACTGCTGGG + Intergenic
1027287385 7:76660992-76661014 ATTAACAGTTTACATTTCTTGGG + Intergenic
1027557581 7:79685468-79685490 TTTAACAGTTACTATTTGTCAGG + Intergenic
1027858863 7:83549101-83549123 ATCAAAAGTTTCTATTTGGTTGG - Intronic
1028194217 7:87886724-87886746 TTAAAAAGTTTCTCTTTTTTGGG - Intronic
1028492691 7:91431073-91431095 ATAAATAATTTCTCTGTGTTGGG + Intergenic
1028897315 7:96056497-96056519 ATTACCAGTTTCTCTGAGGTAGG + Intronic
1029845634 7:103409605-103409627 ATTTATATTTTCTCTGTGTTTGG + Intronic
1030342755 7:108399292-108399314 ATTGATAGTTTCTCTTTTTTGGG - Intronic
1030789993 7:113713118-113713140 ATTAACATTTACATTTTGTTTGG + Intergenic
1030895606 7:115056070-115056092 ATTCTCAGATTGTCTTTGTTTGG + Intergenic
1031692655 7:124809364-124809386 TTTAACATTTTCTCTTTTTTTGG + Intergenic
1031700698 7:124921835-124921857 ATTACCCTTTTCTCTTTTTTGGG - Intronic
1032416581 7:131739872-131739894 ATTGATAATTTCTCTGTGTTGGG + Intergenic
1032897452 7:136266960-136266982 ATTAAGATTCTCTCCTTGTTTGG + Intergenic
1036555702 8:9857865-9857887 ACTAGCAGTGTCACTTTGTTAGG + Intergenic
1038846890 8:31238279-31238301 AATTACATTTTCTCTTTCTTAGG + Intergenic
1039642981 8:39244073-39244095 TTTCACAGTTTTCCTTTGTTAGG - Intronic
1040370375 8:46765102-46765124 ATTTACAATTTTTCTTGGTTAGG + Intergenic
1041133562 8:54731226-54731248 ATTAACATTTTTTGTTTTTTTGG + Intergenic
1041206295 8:55501435-55501457 ATTAACAGTTAGTGTTTGATGGG - Intronic
1041897690 8:62945441-62945463 ATTAAAACTATCACTTTGTTTGG + Intronic
1043113470 8:76217504-76217526 ATTAAAAATTTCTCTTTTTATGG - Intergenic
1043585142 8:81760167-81760189 ATTAACAGTTTATATCTTTTGGG + Intergenic
1044028212 8:87200214-87200236 ATTAACAGTTTCCCTCAGGTTGG - Intronic
1044042079 8:87382801-87382823 ATTAGCAGTCTTTCTTGGTTTGG + Exonic
1044520922 8:93198513-93198535 ATTTACAATTACTCTTTATTTGG + Intergenic
1046105468 8:109660547-109660569 ATTAAAGGTTTCCCTATGTTTGG - Intronic
1046329772 8:112699426-112699448 ATTAACTGTCCCTCTGTGTTCGG - Intronic
1046373760 8:113348382-113348404 ATCACCAGGTTGTCTTTGTTTGG - Intronic
1046595990 8:116261779-116261801 ATTAATAGTTTCTGTCTCTTTGG + Intergenic
1048309673 8:133311032-133311054 TTAAACAGATTCTCTTTGCTTGG + Intergenic
1049890043 9:60177-60199 AATAACATTTTATCTTTCTTTGG - Intergenic
1050041541 9:1500075-1500097 TTTGGCAGTTTCTCTTTTTTTGG - Intergenic
1050967256 9:11821399-11821421 ATACAGAGTTTCTCTGTGTTGGG - Intergenic
1051398354 9:16652164-16652186 ATTTCTTGTTTCTCTTTGTTGGG - Intronic
1051578003 9:18639355-18639377 ATTCTCAGTATCTCTTTGTCTGG - Exonic
1052108786 9:24553266-24553288 ATTAAGAGTTTTTCTATCTTTGG - Intergenic
1052776683 9:32739648-32739670 ATTAACAGTTTGGCTTGGATGGG + Intergenic
1053171018 9:35883580-35883602 AATGTTAGTTTCTCTTTGTTGGG - Intergenic
1053731520 9:41061452-41061474 AATAACATTTTATCTTTCTTTGG - Intergenic
1054789358 9:69240861-69240883 ATTTATTATTTCTCTTTGTTAGG + Intronic
1055047891 9:71949477-71949499 ACTAGCAGTTTCTTTTTTTTTGG - Intronic
1055209917 9:73779298-73779320 ATTTACAGTTTCTCATGGTTGGG - Intergenic
1055264427 9:74478655-74478677 ATTCACAGTTTTTCATTGCTGGG + Intergenic
1055378847 9:75684121-75684143 TTTAACCTTTTCTCATTGTTAGG - Intergenic
1055581229 9:77709035-77709057 ATAAAAAGTTTCTCTTGGTTGGG + Intergenic
1055581553 9:77711597-77711619 ATTAAAAGTTACTATTAGTTGGG + Intergenic
1055884006 9:81037639-81037661 CTTAAGTGTTTCTCTGTGTTGGG + Intergenic
1056878757 9:90367335-90367357 ATTAACACTTTTTCGTTTTTTGG + Intergenic
1203611866 Un_KI270749v1:15590-15612 TCTAACTGTTTCTCTTTCTTAGG - Intergenic
1186385470 X:9106254-9106276 ATTCACAGTTCCTCATTGCTGGG + Intronic
1186985268 X:15006479-15006501 ATCAACAGTGTATATTTGTTTGG - Intergenic
1187077366 X:15948441-15948463 ATTCACAGGTTCTCAATGTTAGG + Intergenic
1187839151 X:23468262-23468284 GTCATGAGTTTCTCTTTGTTGGG - Intergenic
1188378163 X:29458633-29458655 ATAAATAGTTTCTCTTTATTAGG + Intronic
1189451326 X:41134215-41134237 AGTTACAGATTTTCTTTGTTTGG + Intronic
1189588029 X:42481288-42481310 ACTAAGAATTTCTCTTTATTTGG - Intergenic
1190589203 X:51980597-51980619 ATTTACAATTTCTTTGTGTTGGG - Intergenic
1190904432 X:54711714-54711736 ATTTACAGATTGTCTTTATTTGG - Intergenic
1191148193 X:57190751-57190773 ATAAACAGTATACCTTTGTTGGG + Intergenic
1192578640 X:72262681-72262703 ATTATCACTTTCTTTATGTTTGG + Intronic
1192617321 X:72640154-72640176 AGTAAAATTTTCTCTTTTTTTGG - Intronic
1193366881 X:80644827-80644849 TTTAAAAGTTTCTCTGTGTTTGG + Intergenic
1193648371 X:84096658-84096680 ATTAACATTTTCTTTTTACTAGG - Intronic
1193698572 X:84738484-84738506 ATTTTCTGATTCTCTTTGTTAGG + Intergenic
1194323872 X:92486093-92486115 ATTTACATTTTCTTATTGTTTGG - Intronic
1195178651 X:102334970-102334992 ATTTATAATTTCTCTGTGTTGGG + Intergenic
1195180213 X:102352113-102352135 ATTTATAATTTCTCTGTGTTGGG - Intergenic
1195618679 X:106932416-106932438 GGGAACAGTTGCTCTTTGTTAGG - Intronic
1198431705 X:136574000-136574022 AATTACAGTTTCTCTTTTTGGGG - Intergenic
1198849085 X:140946263-140946285 ATTTACAATCTCTGTTTGTTGGG - Intergenic
1199187780 X:144937667-144937689 ATTAACCTTTTTTGTTTGTTTGG - Intergenic
1199769731 X:150967220-150967242 ATAAACAGATCCCCTTTGTTTGG - Intergenic
1200052259 X:153440552-153440574 ATTTCCAGTTTGTCTTTGTGCGG - Intergenic
1200631972 Y:5599182-5599204 ATTTACATTTTCTTATTGTTTGG - Intronic
1200957503 Y:8966707-8966729 ATTAACAATTTTTCCTTGTGTGG - Intergenic
1201633180 Y:16092583-16092605 ATCCACAGTTTCTCTTTCTCTGG + Intergenic
1201684984 Y:16690997-16691019 ATTAAAAGTGTCTCCTTTTTTGG - Intergenic