ID: 1003650065

View in Genome Browser
Species Human (GRCh38)
Location 6:7951289-7951311
Sequence CACCCTTCAGTTGTGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003650065 Original CRISPR CACCCTTCAGTTGTGGAACT AGG (reversed) Intronic
901020051 1:6250800-6250822 CACCCTTTAGCTGTGAGACTGGG + Intronic
901820182 1:11824025-11824047 CACTCTTCAGTTTTGGGATTTGG + Intronic
903879961 1:26501460-26501482 CACCCTGCAGTTGTGGAGAGAGG - Intergenic
904647884 1:31981957-31981979 CATCCTTTAGTTCTGTAACTGGG - Intergenic
907048446 1:51314138-51314160 CACCCTTCAGCTGAGGAGCCTGG - Intronic
907586010 1:55618657-55618679 CACCCTAGAGTTGTGGAATCCGG + Intergenic
909337696 1:74494951-74494973 CACCCTTCATTTGCCTAACTGGG - Intronic
910090484 1:83457165-83457187 ACCCCTTCATTTGTGGAATTTGG - Intergenic
910594798 1:88968767-88968789 GACCCTTCTGTTGTGAATCTTGG - Exonic
914975666 1:152358717-152358739 CAGCCTTCAGTTCTGGCACATGG + Intronic
918891619 1:190279553-190279575 CACTATTCATTTGTGGAACAAGG + Intronic
920263577 1:204706100-204706122 CACAATTCAGTTGTGGAGCAGGG + Intergenic
920409927 1:205750931-205750953 CACCATTAAGTAGTGGACCTGGG - Intergenic
920958847 1:210645973-210645995 CACCCTGCAGTTCTGCAACTGGG + Intronic
922245473 1:223792341-223792363 CAAACTTCAGTTGTGGGAATCGG - Intronic
1063143875 10:3278755-3278777 GACCCCTCAGTTGTGGCCCTCGG + Intergenic
1063327099 10:5115287-5115309 AATTCTTCAGTTTTGGAACTCGG - Intronic
1065811106 10:29444578-29444600 AATTCTTCAGTTTTGGAACTTGG - Intergenic
1067759862 10:49036758-49036780 CACCCAGCAGATGTGGAACAAGG + Intronic
1073862255 10:107760391-107760413 CACCCTTCTCTTGGGTAACTTGG + Intergenic
1073918522 10:108432757-108432779 CAGACTTCAGTTTTGGGACTTGG - Intergenic
1074202742 10:111253629-111253651 CGTCCTTCAGTTTTGGGACTGGG + Intergenic
1074433229 10:113411192-113411214 TACTCTTAAGTTTTGGAACTGGG + Intergenic
1075169305 10:120098322-120098344 CACCCTCCCTTTCTGGAACTTGG - Intergenic
1075822795 10:125329105-125329127 CCCTCCTCATTTGTGGAACTGGG + Intergenic
1078428369 11:11269098-11269120 CACCCTTCAGGGGTGCAAATTGG - Intergenic
1081954457 11:47077830-47077852 CAACCTTCAGTTGGAGAATTAGG + Intronic
1084192083 11:67503970-67503992 CCCCCTTCAGATGTGGGAATGGG - Intronic
1085748663 11:79138204-79138226 AATTCTTCAGTTTTGGAACTTGG + Intronic
1091772774 12:3163985-3164007 CACCCTCCAGATCAGGAACTGGG - Intronic
1092550343 12:9492041-9492063 CACTTTTCAGGTGTTGAACTTGG - Intergenic
1099184177 12:79499715-79499737 AATTCTTCAGTTTTGGAACTCGG - Intergenic
1102389812 12:112540401-112540423 CATTTTACAGTTGTGGAACTTGG - Intergenic
1103464256 12:121129141-121129163 TCCCCTTGAGTTCTGGAACTGGG + Intergenic
1103475945 12:121218702-121218724 CAGCCTTCCGTGGTGGATCTGGG + Intronic
1104602792 12:130164198-130164220 CACCCTCCGGATGTGGAACAGGG - Exonic
1108437821 13:50417855-50417877 CAACCTGCAGTTGTGCAACATGG - Intronic
1110750601 13:79110461-79110483 CGTTCTTCAGTTTTGGAACTTGG + Intergenic
1112760571 13:102689766-102689788 CACCTTTCAGCTGAGGAAATGGG - Intronic
1115899376 14:38127909-38127931 CTCCCTGAAGTTGTGCAACTTGG - Intergenic
1115929010 14:38469279-38469301 CACTTTTCAGTTGTGGATGTGGG - Intergenic
1117208431 14:53469903-53469925 CACCCTTCAGGGAGGGAACTGGG + Intergenic
1118737905 14:68715446-68715468 CCCCCTGCAGTTGTGCAACATGG - Intronic
1118831468 14:69437227-69437249 CACCATGCAGTTCTGCAACTGGG + Intronic
1119589977 14:75877422-75877444 CACCCTTCTGTTGTGGGAGAAGG + Intronic
1120646799 14:87084105-87084127 AATTCTTCAGTTTTGGAACTCGG - Intergenic
1121457463 14:94047630-94047652 CACCTTTCAGTTGGGAAACAGGG - Exonic
1122544491 14:102514667-102514689 CACCCACCAGTGGTGGGACTGGG + Intergenic
1125177153 15:36837435-36837457 GACCCTACTGTTGTAGAACTAGG + Intergenic
1126336543 15:47591355-47591377 GAGCCTTCAGTTGTGCTACTGGG - Intronic
1127663903 15:61125724-61125746 GACCCTTCTGATTTGGAACTGGG - Intronic
1129657626 15:77534752-77534774 CTCCATTCAAATGTGGAACTAGG + Intergenic
1133273587 16:4623885-4623907 TACTTTTCAGTTGAGGAACTTGG - Intronic
1137661016 16:50206500-50206522 CTGACTTCAGTTATGGAACTGGG + Intronic
1140232089 16:73125675-73125697 AATTCTTCAGTTTTGGAACTTGG + Intergenic
1144494182 17:15736466-15736488 GACCCCTCAGTGGGGGAACTTGG + Intronic
1144906079 17:18640210-18640232 GACCCCTCAGTGGGGGAACTTGG - Intronic
1146096834 17:29938039-29938061 CACCTTTCAATTAAGGAACTGGG + Intronic
1147431432 17:40373263-40373285 AATTCTTCAGTTTTGGAACTTGG + Intergenic
1148738413 17:49878165-49878187 CACCCTGCTGCTGTGGCACTGGG + Intergenic
1151356294 17:73560645-73560667 AACCCTTCAGGTGTGGAACATGG + Intronic
1156304181 18:35861332-35861354 CATTCTTCAGTTTTGGGACTCGG + Intergenic
1156901940 18:42310291-42310313 CACCATTCCGTGGTTGAACTTGG - Intergenic
1161012548 19:1967649-1967671 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1161012567 19:1967702-1967724 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1161012588 19:1967763-1967785 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1161012609 19:1967824-1967846 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1161012630 19:1967885-1967907 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1161012651 19:1967946-1967968 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1161012670 19:1968000-1968022 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1161012690 19:1968054-1968076 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1161012712 19:1968115-1968137 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1161012726 19:1968162-1968184 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1161012747 19:1968223-1968245 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1161012766 19:1968277-1968299 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1161012785 19:1968332-1968354 CACCCTTCAGTTCTGCAGGTGGG + Intronic
1165483568 19:36081504-36081526 CACCATTCGCTTCTGGAACTTGG + Exonic
1166148074 19:40850779-40850801 CACCCCAAAGTTGTGGATCTGGG + Intronic
1166727288 19:45036621-45036643 CACACAGCTGTTGTGGAACTGGG - Intronic
924961053 2:35010-35032 CAACCTTCAGTTGTGCACCTGGG - Intergenic
926354399 2:12027305-12027327 CACCACACAGGTGTGGAACTTGG - Intergenic
926782159 2:16483234-16483256 CACCATTCTGATGTGGAAGTGGG - Intergenic
927239133 2:20904602-20904624 AATTCTTCAGTTTTGGAACTCGG + Intergenic
927777556 2:25914112-25914134 AAAACTTCAGTTGTGCAACTTGG - Intergenic
929667330 2:43843219-43843241 CACCCTTCAGGCTTGGAATTTGG - Intronic
929765857 2:44843697-44843719 CCCCCTCCAGTTGTGGATGTGGG + Intergenic
932903652 2:75726899-75726921 GCACCTGCAGTTGTGGAACTTGG - Intergenic
933152323 2:78930467-78930489 CACACTTCAGATGTGGCACAGGG + Intergenic
933906987 2:86903852-86903874 AATCCCTCAGTTCTGGAACTGGG - Intergenic
933969806 2:87461151-87461173 CATCATTCAGATGTGGAATTGGG - Intergenic
934024492 2:87989800-87989822 AATCCCTCAGTTCTGGAACTGGG + Intergenic
936323975 2:111489346-111489368 CATCATTCAGATGTGGAATTGGG + Intergenic
936365182 2:111847829-111847851 AATCCCTCAGTTCTGGAACTGGG + Exonic
943579654 2:189670547-189670569 CGCCTTGCAGCTGTGGAACTTGG + Exonic
944121792 2:196248436-196248458 CATCCTTCATTTGTGCAATTTGG + Intronic
945673856 2:212832622-212832644 CTGCCTTCTGTTGTGGAACACGG + Intergenic
946010219 2:216558447-216558469 GACCCCTCATTTGTGGAATTGGG - Intronic
948769454 2:240242488-240242510 AGCTCTTCAGTTTTGGAACTTGG - Intergenic
1168764308 20:371499-371521 CACCGTTCAGTTTGGGACCTGGG + Intronic
1170626945 20:18037297-18037319 AACCCATCAGTGGTGGAGCTGGG - Intronic
1175158572 20:56991094-56991116 CACCCTTCAGGTAAGGAAGTTGG - Intergenic
1178304825 21:31482646-31482668 CACCCTTCTGTTGTGCTTCTGGG - Intronic
1181620255 22:24086258-24086280 CACTTTTCAGATGTGGAAGTAGG - Intronic
949534316 3:4984065-4984087 CACTCTTCAGTTTGGGAGCTGGG + Exonic
950956202 3:17055938-17055960 TCCCCTTCATTTGTGGCACTGGG - Intronic
960851059 3:122054972-122054994 CACACTTTGGTTGTGGAAATTGG + Intergenic
961329608 3:126130818-126130840 CCGCCATCAGTTGTGGAACTTGG - Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
966738376 3:183209084-183209106 CACCCTTCTGTTTTGGAATGTGG - Intronic
967787471 3:193513149-193513171 CACCTTTCATTTCTGGATCTTGG - Intronic
974853973 4:67437334-67437356 CACAGCTCAGTGGTGGAACTAGG + Intergenic
975976394 4:80102042-80102064 CTCCCTTCAGTTTTGGAGGTGGG - Intronic
976638233 4:87309833-87309855 CATCTTTCAGTTGTGAAAATTGG - Intronic
977817661 4:101433796-101433818 CAACATTCAGTTGAGGAAGTAGG - Intronic
982061333 4:151607015-151607037 CACCCAGCAGTTGGGGAAGTTGG + Intronic
982082079 4:151800147-151800169 CACCCTTCCTTTGTGGAAATGGG + Intergenic
983105427 4:163680622-163680644 CATCCTTCCTCTGTGGAACTAGG + Intronic
984059957 4:174979395-174979417 ACTCCTTCAGTTTTGGAACTCGG - Intergenic
984211077 4:176849377-176849399 TACCCTGAAGTTGTGGAACATGG + Intergenic
985371834 4:189293298-189293320 CATTCTTCAGTTTTGGAACCTGG - Intergenic
985975243 5:3414903-3414925 CACCCTTCAGTTTTGGTGCCTGG - Intergenic
987683730 5:21169856-21169878 AATTCTTCAGTTTTGGAACTCGG - Intergenic
991974375 5:72171770-72171792 CACCCTTCAGGTCTGGAAGAGGG + Intronic
993462454 5:88200440-88200462 CTCCCTCCAGTTGTGCAACAAGG + Intronic
995168592 5:109078684-109078706 CACCCATCATTTGAGTAACTTGG - Intronic
995191812 5:109325861-109325883 CATCCTTCAGTAGTTGGACTCGG - Intergenic
995594612 5:113734461-113734483 CACTCTTCACTTGTGCAGCTTGG - Intergenic
1000730767 5:164830948-164830970 CATTCTTCAGTTTTGGGACTTGG + Intergenic
1001642396 5:173253607-173253629 CTTCCTTCAGTTGTGAAAATGGG + Intergenic
1001644194 5:173268234-173268256 CAGCCTTCAGAAGTGCAACTAGG + Intergenic
1003283265 6:4712378-4712400 CTACCTTCAGTTGGGGACCTTGG - Intronic
1003650065 6:7951289-7951311 CACCCTTCAGTTGTGGAACTAGG - Intronic
1004674722 6:17830570-17830592 CACCCTTCAGGTGTAGAGGTGGG - Intronic
1006575692 6:35043724-35043746 CACCCTTTTGATGTGGATCTGGG + Intronic
1008096337 6:47343159-47343181 CACCCTTGAGTAAAGGAACTGGG + Intergenic
1009244081 6:61213579-61213601 CTGCCTTCAGTGGTGGAAGTCGG + Intergenic
1011214941 6:84995557-84995579 CAACCTTCTCTTGTGGAAGTAGG - Intergenic
1015514015 6:134067182-134067204 CAGTCTTTAGTTTTGGAACTTGG + Intergenic
1016702901 6:147073591-147073613 TCCCCTTCAGTTCAGGAACTTGG + Intergenic
1017152085 6:151289895-151289917 AATCCTTCAGGTGTGGAACTTGG + Intronic
1017730957 6:157314935-157314957 CACCCTTTTGTATTGGAACTGGG + Intronic
1022070506 7:26909024-26909046 CACCATTCAGTTGTTTAACAAGG - Intronic
1024108342 7:46116969-46116991 AGTCCTTCAGTTTTGGAACTTGG + Intergenic
1026559695 7:71438240-71438262 AATTCTTCAGTTTTGGAACTTGG - Intronic
1026623999 7:71976336-71976358 GACCCTTCCTTTGTGGAGCTAGG + Intronic
1027307334 7:76913624-76913646 ACCCCTTCATTTGTGGAATTTGG - Intergenic
1028460583 7:91087460-91087482 CACAGCTCAGTAGTGGAACTAGG - Intronic
1028801539 7:94970844-94970866 CATCCTTGAGTAGTGGAAATGGG + Intronic
1030277025 7:107732579-107732601 AGCTCTTCAGTTTTGGAACTCGG + Intergenic
1032630247 7:133643224-133643246 AGCTCTTCAGTTTTGGAACTTGG - Intronic
1036546842 8:9779459-9779481 AGCCCTTTAGTTTTGGAACTCGG - Exonic
1039703850 8:39987774-39987796 CACCCTGCAGTTATCTAACTCGG + Intronic
1039918933 8:41879605-41879627 CCTCTTTCAGTTGTGGAAATAGG - Intronic
1043116965 8:76268671-76268693 AATTCTTCAGTTTTGGAACTCGG + Intergenic
1044103476 8:88171417-88171439 CACCCTTCATATGTGAAACTGGG - Intronic
1046152733 8:110249518-110249540 CTCCCTTCAGGTGTGGACTTGGG + Intergenic
1047578053 8:126180038-126180060 CACCTTACAGTTGTGGAAATTGG - Intergenic
1048299684 8:133242250-133242272 CACCCCACAGCTGTGGAACTTGG + Intronic
1049700020 8:144006438-144006460 CACCCTTCAGCTGTAGCACAGGG - Intronic
1052368990 9:27643475-27643497 AATTCTTCAGTTTTGGAACTCGG + Intergenic
1052743582 9:32417102-32417124 CACTAGTCAGTGGTGGAACTGGG - Intronic
1057880642 9:98790424-98790446 CACCCTTCAGGCGAGCAACTGGG - Exonic
1060342058 9:122786228-122786250 CACCAGAAAGTTGTGGAACTAGG + Intergenic
1060542652 9:124441171-124441193 TACCCCTCAGTGGTGGGACTTGG - Intergenic
1060788536 9:126469492-126469514 CACCCCTCGGTTGTGGAGCAGGG - Intronic
1060966350 9:127714349-127714371 TACCCTTTTGTTGTGCAACTGGG - Intronic
1187290858 X:17951966-17951988 AGCCAGTCAGTTGTGGAACTAGG + Intergenic
1188437995 X:30184898-30184920 GACACTCCTGTTGTGGAACTTGG - Intergenic
1189126648 X:38454675-38454697 CACCCTGTAGTTGAGAAACTTGG - Intronic
1191952209 X:66604722-66604744 CACCCCTCTCTTGTGGAATTAGG - Intronic
1192940685 X:75908692-75908714 AATTCTTCAGTTTTGGAACTCGG + Intergenic
1194032430 X:88833284-88833306 CGTTCTTCAGTTTTGGAACTTGG - Intergenic
1194947307 X:100084347-100084369 CATTATTCAGTGGTGGAACTGGG - Intergenic
1196325093 X:114393182-114393204 AGCTCTTCAGTTTTGGAACTCGG + Intergenic
1197592591 X:128426892-128426914 AATTCTTCAGTTTTGGAACTTGG - Intergenic
1197738671 X:129872453-129872475 CACCATTTTGTTCTGGAACTTGG - Intergenic
1199268219 X:145851962-145851984 CACCCTTGTGTTGTGGGATTTGG - Intergenic