ID: 1003651444

View in Genome Browser
Species Human (GRCh38)
Location 6:7964504-7964526
Sequence CCCTACAGAGAGTTCTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 527}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003651444_1003651447 -10 Left 1003651444 6:7964504-7964526 CCAAGTCAGAACTCTCTGTAGGG 0: 1
1: 0
2: 4
3: 44
4: 527
Right 1003651447 6:7964517-7964539 CTCTGTAGGGTGAAGGTGAATGG No data
1003651444_1003651450 1 Left 1003651444 6:7964504-7964526 CCAAGTCAGAACTCTCTGTAGGG 0: 1
1: 0
2: 4
3: 44
4: 527
Right 1003651450 6:7964528-7964550 GAAGGTGAATGGGAAGCGTTGGG 0: 1
1: 0
2: 1
3: 14
4: 261
1003651444_1003651449 0 Left 1003651444 6:7964504-7964526 CCAAGTCAGAACTCTCTGTAGGG 0: 1
1: 0
2: 4
3: 44
4: 527
Right 1003651449 6:7964527-7964549 TGAAGGTGAATGGGAAGCGTTGG No data
1003651444_1003651448 -9 Left 1003651444 6:7964504-7964526 CCAAGTCAGAACTCTCTGTAGGG 0: 1
1: 0
2: 4
3: 44
4: 527
Right 1003651448 6:7964518-7964540 TCTGTAGGGTGAAGGTGAATGGG 0: 1
1: 0
2: 1
3: 19
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003651444 Original CRISPR CCCTACAGAGAGTTCTGACT TGG (reversed) Intronic
900816087 1:4847277-4847299 CCCTGCAGGGATTTCTGACCAGG - Intergenic
900852319 1:5153780-5153802 CCCCACACAGAGTTCCCACTGGG + Intergenic
904057373 1:27680320-27680342 CCCCACACAGAGTCCTTACTGGG - Intergenic
904572010 1:31473322-31473344 CCCCACACAGAGTTCCTACTGGG - Intergenic
905496246 1:38390133-38390155 CCCCACACAGAGTTCCCACTGGG - Intergenic
906833543 1:49059516-49059538 CCCTACACAGAGTTCCCACTGGG + Intronic
907491893 1:54813924-54813946 CCCTACAGAGAGGATTTACTGGG + Exonic
907863010 1:58372014-58372036 CCCCACAGAGAGTCCCCACTGGG + Intronic
908885213 1:68780992-68781014 CCCCACACAGAGTTCCCACTGGG + Intergenic
908960924 1:69695947-69695969 CCCTGCAGAGAGTCCCTACTAGG + Intronic
909250264 1:73344440-73344462 CCCCACACAGAGTTCCTACTGGG + Intergenic
909274437 1:73666384-73666406 CCCCACACAGAGTTCCTACTGGG + Intergenic
909373456 1:74913843-74913865 CCCCACACAGAGTCCCGACTGGG - Intergenic
909510585 1:76447923-76447945 CCCCACAGAGAGTCCTTACTGGG + Intronic
909599778 1:77449068-77449090 CCCTACACAGAGTCCCTACTGGG + Intronic
909757024 1:79239694-79239716 CCCAACACAGAGTCCTCACTCGG - Intergenic
910270247 1:85386691-85386713 CCCTACACAGAGTCCCCACTGGG - Intronic
910414311 1:86981863-86981885 CCCAACAGAGAGTCCCCACTGGG - Intronic
911275017 1:95850021-95850043 CCCCACACAGAGTCCTCACTAGG + Intergenic
911515762 1:98866432-98866454 CCCCACACAGAGTTCCTACTGGG - Intergenic
911541628 1:99164233-99164255 CCCCACACAGAGTTCCTACTAGG + Intergenic
911790947 1:102014658-102014680 CCCCACACAGAGTTCTCACTGGG + Intergenic
912070277 1:105800871-105800893 CCCCACACAGAGTTTTTACTAGG - Intergenic
912121716 1:106479676-106479698 CCCCACACAGAGTCCCGACTGGG + Intergenic
912153113 1:106883085-106883107 CCCTACACAGAGTCCCCACTGGG - Intergenic
912165696 1:107040031-107040053 CCCCACAGAGAGTCCCTACTGGG + Intergenic
912182723 1:107237930-107237952 CCCCACAGAGAGTGCCTACTGGG + Intronic
912815877 1:112827616-112827638 TCCTACAGGGAGTTCCTACTAGG - Intergenic
912907354 1:113720747-113720769 CCGCACATAGAGTTCTCACTGGG - Intronic
913081829 1:115395357-115395379 CCCCACACAGAGTTCCTACTGGG - Intergenic
913166932 1:116196631-116196653 GGCTACAGTGAGTTATGACTGGG + Intergenic
914523488 1:148439389-148439411 CCCCACACAGAGTCCTTACTGGG + Intergenic
915654831 1:157350804-157350826 CCCCACAAAGAGTTCCTACTGGG - Intergenic
916036853 1:160929835-160929857 GCCTTCAGAGAGGTCTGAGTAGG - Intergenic
916360563 1:163962766-163962788 GCCCACAGTGAGTACTGACTGGG - Intergenic
916467230 1:165084543-165084565 TCCTACACAGAGTTCCCACTGGG + Intergenic
917578052 1:176344898-176344920 CCCCACAGAGAGTCCCCACTGGG - Intergenic
917879627 1:179321552-179321574 CACAACAAAGACTTCTGACTTGG - Intronic
918727787 1:187947799-187947821 CCCCACACAGAGTCCTTACTGGG + Intergenic
919065995 1:192693470-192693492 CCCCACACAGAGTCCTTACTGGG - Intergenic
919200443 1:194349067-194349089 CCCTACAAAGAGTTCCTACTGGG + Intergenic
919398642 1:197081648-197081670 CCCCACACAGAGTCCTTACTGGG + Intergenic
920594503 1:207255465-207255487 CCCTACACAGAGTCCCCACTGGG - Intergenic
921282224 1:213578358-213578380 CCGTACACAGAGTTCCCACTGGG + Intergenic
921452349 1:215323843-215323865 CCCCACACAGAGTTCACACTGGG - Intergenic
923458630 1:234187889-234187911 CCCTACCCGGAGTTCTGGCTAGG - Intronic
1062782448 10:226745-226767 CCCTCCAAAGAGTTTTGTCTTGG + Intronic
1064909450 10:20384386-20384408 CACCACAGAGAGTTCCTACTAGG + Intergenic
1066062469 10:31736341-31736363 CCCTACACAGAGTCCCTACTGGG - Intergenic
1067499276 10:46787056-46787078 CCCTGCAGAGAGCCCGGACTGGG + Intergenic
1067595353 10:47553268-47553290 CCCTGCAGAGAGCCCGGACTGGG - Intergenic
1067911482 10:50350881-50350903 CCCCACATAGAGTTCCTACTGGG + Intronic
1068155162 10:53188343-53188365 CCCCACACAGAGTCCTCACTGGG + Intergenic
1068235823 10:54231501-54231523 CCCCACACAGAGTTCCCACTGGG + Intronic
1068354796 10:55897295-55897317 CCCCACACAGAGTCCTTACTAGG - Intergenic
1068404334 10:56570421-56570443 CCCCACACAGAGTTCACACTGGG - Intergenic
1069754661 10:70766281-70766303 CCCCACACAGAGTCCTTACTGGG + Intergenic
1071018770 10:81028262-81028284 ACCTACAGAGAATGCTGAGTAGG - Intergenic
1071442811 10:85718178-85718200 CCCTACACAGAGTCCCTACTGGG - Intronic
1071697115 10:87888038-87888060 CACTACAGAGAGTCCCTACTAGG + Intronic
1074424514 10:113339116-113339138 CCCTACAGAGATTTCTAGCTGGG - Intergenic
1074537441 10:114338761-114338783 TCCTCCAGAAAGTTCTGTCTTGG - Intronic
1074544220 10:114389944-114389966 GCCTACAAATAATTCTGACTTGG - Intronic
1075488338 10:122846050-122846072 CCCTACAGAGAGCTTCCACTGGG - Exonic
1075780566 10:125014688-125014710 CCCTCCAGAAAGCACTGACTTGG + Intronic
1077730640 11:4725708-4725730 CCCTTCAGAGAGATCTGAGGTGG + Intronic
1077740807 11:4843247-4843269 CCCCACACAGAGTTCCCACTGGG - Intronic
1078339135 11:10486553-10486575 CCTTACAGAGATTTCTGTCTCGG + Intronic
1078959501 11:16248344-16248366 CCCTACACAGAGTCCCCACTGGG - Intronic
1079341022 11:19611874-19611896 CCCCACACAGAGTCCTTACTGGG - Intronic
1079856371 11:25610388-25610410 CCCTACACAGAGTCCCTACTGGG - Intergenic
1079873495 11:25829491-25829513 CCCAACAGAGAGTCCCCACTAGG - Intergenic
1080341733 11:31272899-31272921 CCCTACACAGAGTTCCTACTGGG - Intronic
1080437792 11:32262236-32262258 CACTGCAGAGAGTTCCCACTAGG - Intergenic
1080646604 11:34192502-34192524 CCCTTCCCAGAGTTCTGATTGGG - Intronic
1080817460 11:35772311-35772333 CCCTACACAGAGTCCCTACTGGG + Intronic
1080904022 11:36522576-36522598 CCCCACATAGAGTTCCTACTGGG + Intronic
1081315549 11:41625390-41625412 CCCTACACAGAGTCCCCACTGGG - Intergenic
1082626767 11:55496137-55496159 CCCCACACAGAGTTCCCACTGGG - Intergenic
1082947972 11:58780427-58780449 CCCCACACAGAGTTCCCACTGGG - Intergenic
1085600838 11:77854790-77854812 CCCTACACAGAGTCCCCACTGGG - Intronic
1086605021 11:88685956-88685978 CCCCACACAGAATCCTGACTGGG + Intronic
1087496266 11:98894098-98894120 CCCTACACAGAGTCCCTACTGGG - Intergenic
1087668995 11:101083379-101083401 CCCTGCACAGAGTTCCCACTGGG + Intronic
1087725178 11:101708036-101708058 CCCCACACAGAGTCCTTACTGGG + Intronic
1087730019 11:101768106-101768128 CCCTACACAGAGTCCCCACTGGG - Intronic
1087807265 11:102568723-102568745 CCCAACACAGAGTCCTCACTGGG - Intergenic
1088109656 11:106247038-106247060 CCCCACAGAGAGTCCCCACTGGG + Intergenic
1088850959 11:113702999-113703021 CCCCACACAGAGTTCCCACTGGG + Intronic
1089364616 11:117913892-117913914 CCCTGCAGTGAGGTTTGACTGGG - Exonic
1089414217 11:118273449-118273471 CTCTACAGAGAGTTCTGGACTGG + Intergenic
1091038098 11:132251987-132252009 CCAGACAGAGAGTGATGACTGGG + Intronic
1091244645 11:134081719-134081741 CCCTACACAGAGTCCCTACTGGG + Intronic
1092670558 12:10856314-10856336 CCCTACACAGAGTCCCCACTGGG + Intronic
1092853059 12:12648126-12648148 CCCCACAGAGAGTCCCCACTGGG - Intergenic
1093333985 12:17878550-17878572 CCCTACACAGAGTCCTCACTTGG - Intergenic
1093596865 12:20972720-20972742 CCCTATAGAGAGTTTCCACTGGG + Intergenic
1093681663 12:22009814-22009836 CCCTACACAGAGTCCCCACTGGG + Intergenic
1093748722 12:22773529-22773551 CCATGAACAGAGTTCTGACTTGG - Intergenic
1094489223 12:30948310-30948332 CCCCACACAGAGTTCCTACTGGG - Intronic
1094762595 12:33551547-33551569 CCCCACACAGAGTCCTCACTGGG + Intergenic
1095039726 12:37427624-37427646 CCCTACACAGAGTCCCTACTGGG + Intergenic
1095235038 12:39785542-39785564 CCCCACAGAGAGTCCCTACTGGG + Intronic
1095731520 12:45511421-45511443 CCCAACACAGAGTCCTTACTGGG - Intergenic
1096904952 12:54926798-54926820 CCCCACACAGAGTTCCCACTGGG + Intergenic
1096958040 12:55546813-55546835 CACTGCAGAGAGTCCTCACTAGG - Intergenic
1097136895 12:56864587-56864609 CCCCACATAGAGTTCCCACTGGG + Intergenic
1098238608 12:68442919-68442941 CCCCACACAGAGTTCCTACTGGG - Intergenic
1099305882 12:80955283-80955305 CACTACCCAGAGTTTTGACTTGG - Intronic
1099386470 12:82019014-82019036 CCCTACAGAGAATCCCCACTGGG + Intergenic
1100086534 12:90917653-90917675 CCCTCCAGAGAGCTCTGCATTGG + Intronic
1100589239 12:96009920-96009942 CCTTAAAGAGAGTTGTGACTGGG + Intronic
1101647266 12:106643019-106643041 TCCTACAGGGAGTTCTGAGGTGG + Intronic
1102314820 12:111879054-111879076 GCCTACTGGGAGTTTTGACTGGG + Intronic
1103880744 12:124164094-124164116 CCCCACAGAGAGTCCCTACTGGG - Intronic
1104169358 12:126265157-126265179 CCCTACAGACATTTCTGTTTGGG - Intergenic
1104222935 12:126803351-126803373 CCCTACAGACATTTCTGTTTGGG - Intergenic
1104719911 12:131039521-131039543 CCCTGCAGGGAGCTCTGACAAGG + Intronic
1104829973 12:131743718-131743740 CCCCACAGAGAGTCCCTACTGGG - Intronic
1105306938 13:19175522-19175544 CACTGCAGTCAGTTCTGACTGGG + Intronic
1105990797 13:25618701-25618723 CCCTACATAGAGATCTTGCTGGG - Intronic
1106338882 13:28809482-28809504 CCCCACAGAGAGTCCCCACTGGG + Intergenic
1107163606 13:37260145-37260167 CCCTACAGAGAGTTCTATGAAGG - Intergenic
1107234589 13:38153335-38153357 CCCCACAGAGAGTCCATACTGGG - Intergenic
1107700376 13:43041186-43041208 CCCTGCAGAGACCTCTGCCTAGG - Intronic
1108219290 13:48216745-48216767 CCCCACATAGAGTCCCGACTGGG + Intergenic
1108981791 13:56523558-56523580 CCCTACACAGAGTCCCCACTGGG - Intergenic
1109324632 13:60852720-60852742 CCCCACACAGAGTCCTTACTGGG - Intergenic
1109384379 13:61607987-61608009 CCCCACAGAGAGTTCCCACCAGG - Intergenic
1109416883 13:62051834-62051856 CCCCACACAGAGTCCTCACTGGG + Intergenic
1110140342 13:72121687-72121709 GCCCACAGAGAGTTTTGTCTAGG + Intergenic
1110914783 13:81008450-81008472 CCCCACACAGAGTTCCCACTAGG + Intergenic
1110926841 13:81164478-81164500 CCCCACACAGAGTTCCTACTGGG - Intergenic
1111107810 13:83669411-83669433 CCTTACAGAGAGTCCCTACTAGG + Intergenic
1111144869 13:84166853-84166875 CCCCACAGAGAGTCCTCACTGGG - Intergenic
1111218791 13:85178575-85178597 CCCAACACAGAGTCCTTACTGGG - Intergenic
1111227086 13:85288485-85288507 CCCAACACAGAGTTCCCACTGGG - Intergenic
1111334274 13:86800787-86800809 CCCCACACAGAGTCCTTACTGGG + Intergenic
1111584004 13:90261287-90261309 CCCCACACAGAGTCCTCACTGGG - Intergenic
1112067897 13:95814139-95814161 CCCCACAGAGAGTCCCCACTGGG + Intronic
1112790255 13:102995245-102995267 CCCTACACAGAGTCCCCACTGGG - Intergenic
1114954893 14:27805393-27805415 CCCCACAGAGAGTCCCCACTGGG + Intergenic
1115121420 14:29941972-29941994 CCCCACACAGAGTTCCCACTGGG + Intronic
1115130347 14:30046690-30046712 CCCCACACAGAGTTCCTACTAGG - Intronic
1115942250 14:38622404-38622426 CCCCACACAGAGTTCTTACTGGG + Intergenic
1116022965 14:39484024-39484046 CCCTTCAGAGTGTTCTGAATTGG + Intergenic
1116500633 14:45617066-45617088 CACTGCAAAGAGTCCTGACTAGG - Intergenic
1116718305 14:48456696-48456718 GCCTACAGATAGTACTAACTTGG + Intergenic
1116854210 14:49937660-49937682 CCCCACACAGAGTTCCTACTGGG + Intergenic
1116931327 14:50694114-50694136 CCCTACACAGAGTCCCTACTAGG - Intergenic
1116985249 14:51212163-51212185 CCCCATAGAGATTTCTGAGTGGG + Intergenic
1117749263 14:58903287-58903309 CCCCACACAGAGTTCCCACTGGG + Intergenic
1117958924 14:61144241-61144263 CCCAACATAGAGTTCCTACTGGG - Intergenic
1117964104 14:61189257-61189279 CCTTACTGAGATTTCTCACTAGG + Intronic
1118083374 14:62387551-62387573 CCCCACACAGAGTCCTCACTAGG + Intergenic
1118402831 14:65395309-65395331 CCCCACACAGAGTTCCAACTGGG - Intergenic
1120104635 14:80480182-80480204 CCCCACACAGAGTCCTTACTGGG - Intronic
1120420222 14:84275931-84275953 CCCTACAGGGAGTGATGACTAGG + Intergenic
1120590981 14:86372929-86372951 CCCTACACAGAGTCCACACTGGG + Intergenic
1120637004 14:86965253-86965275 CCCCACACAGAGTTCCTACTGGG + Intergenic
1121063422 14:90938454-90938476 CCCTACACAGAGTTCCTACTGGG - Intronic
1124664582 15:31581400-31581422 CCCTACACAGAGTCCCTACTGGG - Intronic
1124691376 15:31826136-31826158 CCCCACACAGAGTCCTTACTGGG - Intronic
1124879349 15:33626976-33626998 CCCCACACAGAGTCCTCACTGGG + Intronic
1126283100 15:46979718-46979740 CACTACAGAAAGCCCTGACTAGG + Intergenic
1127164679 15:56232181-56232203 CCCTACACAGAGTCCCCACTGGG - Intronic
1127186498 15:56485955-56485977 CCCTACACAGAGTCCCCACTGGG + Intergenic
1127240535 15:57108625-57108647 CCTTAGAGAGAGATCTGGCTTGG + Intronic
1128548009 15:68580211-68580233 CTCTTCAGAGAGATCTGTCTGGG + Intronic
1129900444 15:79144159-79144181 CCCTACACAGAGTTTCCACTGGG - Intergenic
1130439184 15:83934024-83934046 CCCTACACAGAGTCCCCACTGGG + Intronic
1130890319 15:88127921-88127943 TCCTTCAGAGAATTCTGAATTGG - Intronic
1131259132 15:90879576-90879598 CCCTACAGAGAGTGCTGGTAGGG - Intronic
1131514063 15:93065876-93065898 GCCTACAGAGAGCACTGACGGGG - Intronic
1132194070 15:99897091-99897113 CCCCACACAGAGTCCTTACTGGG - Intergenic
1135083527 16:19456445-19456467 TCCTGCAGAGAATTCTGTCTTGG - Intronic
1135208911 16:20507386-20507408 CCCCACACAGAGTTCCCACTGGG - Intergenic
1135925999 16:26694674-26694696 CCCTACACAGAGTCCCCACTGGG - Intergenic
1136642400 16:31577938-31577960 CCCCACACAGAGTTCCTACTGGG + Intergenic
1137255241 16:46769587-46769609 CCCCAGTGAGAATTCTGACTGGG - Intronic
1138198453 16:55071603-55071625 CCCTACACAGAGTCCTGACTGGG - Intergenic
1140256666 16:73342924-73342946 TCCAACAGAGAGTTCTGACCAGG + Intergenic
1140479193 16:75253380-75253402 CCCTGCAGAGACTGCTGCCTGGG - Intronic
1141018841 16:80475910-80475932 CCATACACATAGTTCAGACTTGG + Intergenic
1141173140 16:81703824-81703846 CCCTACAGAGAGCTGTTCCTGGG - Intronic
1141272751 16:82555950-82555972 CCCCACACAGAGTTCCCACTGGG - Intergenic
1141291045 16:82718325-82718347 CCCTACAGAGGCTGCTTACTGGG - Intronic
1141880688 16:86856993-86857015 CCCTACAGAGGGGTATTACTTGG + Intergenic
1141952158 16:87346125-87346147 CCCTACAGAGGGTTGTGTCCTGG + Intronic
1143152872 17:4818095-4818117 CTCTACATTGAGGTCTGACTGGG + Exonic
1144814503 17:18024588-18024610 CCCTGCAGAAAGCACTGACTGGG - Intronic
1145378151 17:22370824-22370846 CCCTACACAGAGTCCCTACTGGG - Intergenic
1151388364 17:73769258-73769280 CCATCCCGAGGGTTCTGACTTGG - Intergenic
1152300284 17:79491453-79491475 CCCTACTGAGATTCCTGCCTTGG - Intronic
1153706613 18:7751792-7751814 CCCTAGAGAGTGAACTGACTAGG - Intronic
1153784904 18:8525985-8526007 CCGTACAGAGAGCTCTCCCTAGG - Intergenic
1155007663 18:21742173-21742195 CCCTTCAGACAGTTATCACTTGG - Intronic
1158299218 18:56033224-56033246 CCCTACAGAGAGTTCCCACTGGG - Intergenic
1158829693 18:61263813-61263835 CCCTCCTCAGAGTTCTGGCTGGG - Intergenic
1158833291 18:61303618-61303640 CCCTACACAGAGTCCCCACTTGG + Intergenic
1159265305 18:66072235-66072257 CCCAACACAGAGTTCTCACCAGG + Intergenic
1159481478 18:68995747-68995769 CCCCACACAGAGTCCCGACTGGG + Intronic
1159641232 18:70864969-70864991 CCCCACACAGAGTTCCTACTGGG + Intergenic
1159803023 18:72923837-72923859 CCCCACACAGAGTCCTCACTGGG - Intergenic
1160082059 18:75737176-75737198 CCCCACACAGAGTTCCTACTGGG + Intergenic
1160599429 18:80001387-80001409 CCCCACACAGAGTCCTCACTAGG + Intronic
1164214143 19:23129190-23129212 CCCCACACAGAGTCCTTACTGGG + Intronic
1164414053 19:28031479-28031501 CCCCACAAAGAGTTCCTACTTGG - Intergenic
1164851139 19:31485212-31485234 CCCTACACAGAGTCCCTACTCGG - Intergenic
1165639838 19:37375045-37375067 GCCTACAGAGATTTTTGGCTAGG + Intronic
1166141988 19:40810179-40810201 CCCTACAGGGAGATTGGACTAGG + Intronic
1166324656 19:42041851-42041873 CCCTACTGGGATATCTGACTGGG + Intronic
1166526425 19:43513240-43513262 CCCCACAGAGAGTTCCCACTGGG + Intronic
1167783021 19:51612799-51612821 TCCCACAGGGAGTTCTAACTGGG - Intronic
925443512 2:3908341-3908363 CCCAACACAGAGTTCCTACTGGG - Intergenic
925489418 2:4375454-4375476 CCCTACAGAGAGTCTCCACTGGG - Intergenic
925874568 2:8300995-8301017 CCCTGCAGAGAGCTCTCAATAGG - Intergenic
926214116 2:10893168-10893190 CCCTACAGAGAGCCCCTACTAGG - Intergenic
926508149 2:13741229-13741251 CCCTACACAGAGTCCCTACTGGG + Intergenic
928048910 2:27968516-27968538 CCCCACACAGAGTTCCTACTGGG + Intronic
928257417 2:29735190-29735212 CCCTACAGGGGGTTCTGATTTGG + Intronic
928586453 2:32763280-32763302 CCCTCCAGACAGTTCAAACTTGG - Intronic
929839759 2:45446059-45446081 CCCTCTAGAGAGGTCTGACTTGG + Intronic
930419695 2:51135177-51135199 CCCCACACAGAGTTCCCACTGGG + Intergenic
930939740 2:56998943-56998965 CCCCACAGAGAGTCCCCACTAGG - Intergenic
931154671 2:59614804-59614826 CCCTACACAGAGTACCTACTGGG - Intergenic
931494082 2:62783367-62783389 CCCTACACAGAGTCCCCACTGGG - Intronic
932847607 2:75151663-75151685 CCCCACACAGAGTTCCTACTGGG + Intronic
932849558 2:75171462-75171484 CCCTACTCAGAGTTCCCACTGGG + Intronic
933209714 2:79552495-79552517 CCCTACACAGAGTCCCCACTGGG - Intronic
934055015 2:88244148-88244170 CCCTACACAGAGTCCCCACTGGG + Intergenic
935139907 2:100343857-100343879 CCCTACACAGAGTCCCCACTAGG + Intergenic
935448888 2:103187414-103187436 CCCCACACAGAGTTCCCACTAGG + Intergenic
936753730 2:115678624-115678646 CCCTACACAGAGTCCCCACTAGG + Intronic
936940894 2:117883057-117883079 CCCTACACAGAGTCCCCACTGGG + Intergenic
937118178 2:119424382-119424404 CCCAACAGAGAGCTCTTCCTTGG - Intergenic
937360396 2:121225467-121225489 CCTTCCAGAGAGTGCTGACCTGG - Intronic
937841219 2:126526535-126526557 CCCTGCAGAGGCTTCTGCCTGGG + Intergenic
937881242 2:126866436-126866458 CCCGACATAGAGTTCCTACTGGG - Intergenic
939125407 2:138172185-138172207 CCTCACACAGAGTCCTGACTGGG + Intergenic
939145644 2:138411542-138411564 CCCTCCAAAGAGAACTGACTTGG + Intergenic
939482871 2:142771249-142771271 CCCTACACAGAGTTCCCACTGGG + Intergenic
940090855 2:149915269-149915291 TCCTACCAAGAATTCTGACTTGG - Intergenic
941303136 2:163828717-163828739 CCCCACAGAGAGTCCCTACTGGG - Intergenic
942889039 2:180964935-180964957 CCCCACACAGAGTTCCTACTGGG + Intergenic
942904712 2:181166786-181166808 CCCCACACAGAGTCCTCACTGGG - Intergenic
943372131 2:187028476-187028498 CCCCACACAGAGTTCCCACTGGG + Intergenic
943395575 2:187328899-187328921 CCCCACACAGAGTTCCCACTGGG + Intergenic
943446870 2:187996702-187996724 ACCTACAGACACTTCTTACTGGG + Intergenic
943609450 2:190015137-190015159 CCCCACAGAGAGTCCTCACTGGG - Intronic
943702299 2:190999817-190999839 CCCCAAAAAGAGATCTGACTTGG + Intronic
943804928 2:192112088-192112110 CCCCACACAGAGTTCTCACTGGG + Intronic
946644145 2:221815542-221815564 CCCCACACAGAGTTCCCACTGGG + Intergenic
947183326 2:227432069-227432091 CCCCACAGAGAGTCCTCACTGGG - Intergenic
947443201 2:230141251-230141273 CCCCACACAGAGTCCTCACTGGG + Intergenic
947488160 2:230571339-230571361 CCCCACACAGAGTTCCCACTGGG - Intergenic
947546604 2:231014975-231014997 CCCTACAGGGAGTCCCAACTTGG + Intronic
948016725 2:234697184-234697206 CCCCACAAAGAGTTCCCACTGGG - Intergenic
948233356 2:236368061-236368083 TCCTACTGAGAATTCTGAGTGGG - Intronic
1170364908 20:15587965-15587987 CCCCACACAGAGTTCCTACTGGG - Intronic
1171534311 20:25872836-25872858 CCCTACACAGAGTCCCTACTGGG + Intergenic
1172893156 20:38281392-38281414 CCCTACATAGAGTTCCCACTAGG - Intronic
1173706066 20:45111121-45111143 CCCTGCAGAGAGAGCTGGCTTGG - Intronic
1174082410 20:47979794-47979816 CCATAGAGAGAGCACTGACTTGG - Intergenic
1176689020 21:9881712-9881734 CCCCACAGAGAGTCCCTACTGGG - Intergenic
1176877738 21:14149997-14150019 CCCTATACAGAGTTCCCACTGGG - Intronic
1177206462 21:18016619-18016641 CCCCACATAGAGTTTTCACTGGG + Intronic
1177334682 21:19707931-19707953 CCCCACACAGAGTTCCTACTTGG + Intergenic
1177478186 21:21651237-21651259 CCCCACAGAGAGTCCCTACTGGG + Intergenic
1177517685 21:22176639-22176661 CCCTACACAGAGTCCCCACTGGG + Intergenic
1177525745 21:22287850-22287872 CCCTACACAGAGTCCCCACTGGG + Intergenic
1177628801 21:23700533-23700555 CCCTACACAGAGTTCCCACCAGG + Intergenic
1177645878 21:23899400-23899422 CCCCACAAAGAGTTCCCACTGGG - Intergenic
1177742198 21:25167988-25168010 CCCTACACAGAGTTCCTACTGGG + Intergenic
1177765229 21:25450071-25450093 CCCCATACAGAGTTCTCACTGGG - Intergenic
1178004075 21:28196762-28196784 CCCCACACAGAGTTCCTACTAGG - Intergenic
1179959384 21:44759542-44759564 CCCTACAGAGGGCTCTGGTTGGG + Intergenic
1180175072 21:46083338-46083360 GCCTCCAGGGAGTCCTGACTCGG + Intergenic
1180596253 22:16975386-16975408 CCCTCCAGGAAGTTCTAACTGGG + Intronic
949665344 3:6332134-6332156 CCCCACACAGAGTCCTTACTGGG + Intergenic
950179008 3:10897795-10897817 CCCTACACAGAGTCCCTACTGGG - Intronic
950244980 3:11407498-11407520 CCCCACACAGAGTTCCTACTGGG - Intronic
952141185 3:30480633-30480655 CCCAAAAGAGAGTCCTCACTGGG + Intergenic
952596770 3:35027930-35027952 CCCCACAGAGAGTCCCTACTGGG - Intergenic
952939685 3:38432958-38432980 CCCCACAGAGAGTTCCCACTGGG - Intergenic
953094961 3:39766237-39766259 CCCTACACAGAGTCCCCACTGGG - Intergenic
953645205 3:44747200-44747222 CACTACTGAGAGTCCTCACTAGG - Intronic
953685814 3:45077699-45077721 CCCCACAGAGAGTCCCTACTGGG + Intergenic
956489220 3:69753429-69753451 CCCTACACAGAGTCCCCACTGGG + Intronic
957039141 3:75322895-75322917 CCCTACAGATAGTTCTTCTTGGG + Intergenic
957105625 3:75883526-75883548 CCCCACAGAGAGTCCCTACTGGG - Intergenic
957113201 3:75992600-75992622 CCCCACAGAGAGTCCCTACTGGG + Intronic
957477094 3:80739308-80739330 CCCCACACAGAGTTCCCACTGGG - Intergenic
957693008 3:83596416-83596438 CCCCACAGAGAGTCCCTACTGGG + Intergenic
957953131 3:87150024-87150046 CCCCACACAGAGTCCTTACTGGG - Intergenic
957981759 3:87519796-87519818 CCCCACAGAGAGTCCCTACTGGG + Intergenic
958927999 3:100179786-100179808 CCCTACACAGAGTCCCCACTGGG - Intergenic
959233619 3:103690398-103690420 CCCCACAGAGAGTCCCTACTAGG - Intergenic
960341399 3:116479231-116479253 CCCCACAGAGAGTCCCCACTAGG + Intronic
960461699 3:117943709-117943731 CACTACAGACAGTTCACACTAGG + Intergenic
960496764 3:118384254-118384276 CCCCACAGAGAGTCCCTACTGGG + Intergenic
960499501 3:118419370-118419392 CCCTACACAGAGTACCCACTGGG - Intergenic
961087301 3:124079115-124079137 CCCTACAGATAGTTCTTCTTGGG + Intergenic
962440162 3:135406178-135406200 CCCCACAGAGAGTCCCTACTGGG - Intergenic
962589350 3:136873020-136873042 CCCCACACAGAGTTCCTACTCGG + Intronic
962672821 3:137726466-137726488 CCCTACACAGAGTTCCTACTAGG - Intergenic
962811886 3:138966089-138966111 CCCTACAGAGAGGTTTTATTTGG + Intergenic
964154168 3:153564479-153564501 CCCCACACAGAGTCCTCACTGGG + Intergenic
965108391 3:164388090-164388112 CCCTACACAGAGTCCCTACTGGG - Intergenic
965198596 3:165629191-165629213 CCCTACACAGAGTCCCTACTAGG - Intergenic
965198873 3:165631464-165631486 CCCTACATAGAGTCTTCACTGGG + Intergenic
965437888 3:168675024-168675046 CCCTGCAGTGAGTTCTGCCCTGG - Intergenic
965857212 3:173103293-173103315 CCCCACACAGAGTTCCTACTGGG - Intronic
965865078 3:173196021-173196043 CCCCACACAGAGTCCTTACTGGG + Intergenic
966059159 3:175734132-175734154 CCCCACAGAGAGTCCCTACTGGG - Intronic
966115716 3:176458446-176458468 CCCTACACAGAGTCCCTACTGGG + Intergenic
966302718 3:178496952-178496974 CCCAACACAGAGTCCTCACTGGG + Intronic
966884782 3:184371089-184371111 CCCTAGAGTGAGGTCAGACTAGG + Intronic
967805987 3:193715065-193715087 CCCTACACAGAGTTGCCACTGGG + Intergenic
969128764 4:4975013-4975035 CCCCACAGAGAGTGCCCACTGGG + Intergenic
969996400 4:11317262-11317284 CCCAACACAGAGTCCTTACTGGG - Intergenic
970302107 4:14692313-14692335 CCCCACACAGAGTTCCCACTGGG + Intergenic
970721811 4:18997167-18997189 CCCCACTGAGAGTCCTCACTGGG - Intergenic
970868144 4:20782332-20782354 CCCTACACAGAGTCCCTACTGGG - Intronic
971546568 4:27893900-27893922 CCCCACAGAGAGCTCCCACTAGG - Intergenic
971943584 4:33245828-33245850 CCCCACAGAGAGTCCCCACTGGG - Intergenic
972103000 4:35445850-35445872 CCCCACACAGAGTTCCCACTGGG + Intergenic
972137379 4:35908769-35908791 CCCCACACAGAGTTCGTACTGGG + Intergenic
972582461 4:40406872-40406894 CCCTACACAGAGTCCCTACTGGG + Intergenic
973131511 4:46653885-46653907 CACCACATAGAGTTCTCACTGGG - Intergenic
974171380 4:58270900-58270922 CCCCACACAGAGTCCTGACTGGG + Intergenic
974172276 4:58281701-58281723 CCCCACACGGAGTCCTGACTGGG + Intergenic
974724199 4:65777800-65777822 CCCTACACAGAGTCCCCACTAGG + Intergenic
975506504 4:75144249-75144271 CCCTACACAGAGTTCCTACCAGG - Intergenic
976050768 4:81009388-81009410 CCCCACACAGAGTTCCCACTGGG + Intergenic
976444823 4:85118189-85118211 CCCCACACAGAGTTCCTACTGGG + Intergenic
976988030 4:91327129-91327151 CCCCACATAGAGTTCCCACTGGG - Intronic
977060581 4:92253740-92253762 CCCTACACAGAGTCCATACTGGG - Intergenic
977197853 4:94083974-94083996 CCCTACACAGAGTCCTTACTGGG - Intergenic
977702486 4:100036026-100036048 CCCCACACAGAGTCCTCACTGGG - Intergenic
977832277 4:101608331-101608353 CCCCACACAAAGTTCTTACTAGG + Intronic
977903998 4:102455187-102455209 CACTGCAGAGAGTCCTCACTAGG - Intergenic
978044961 4:104114505-104114527 CCCTACACAGAGTCCCCACTGGG - Intergenic
978101047 4:104841256-104841278 CCCCACACAGAGTCCCGACTGGG - Intergenic
978492421 4:109323219-109323241 CCCCACACAGAGTTCCCACTGGG - Intergenic
979065905 4:116132712-116132734 CCCCACACAGAGTTCCTACTGGG - Intergenic
979078420 4:116303829-116303851 CCCTACACAGAGTCCCTACTGGG + Intergenic
979139193 4:117151114-117151136 ACCCACACAGAGTCCTGACTGGG - Intergenic
979610235 4:122682104-122682126 CCCCACACAGAGTCCTCACTGGG + Intergenic
980386098 4:132089341-132089363 CCCTACACAGAGTCCCCACTGGG + Intergenic
981359652 4:143831749-143831771 CCCCACATAGAGTTCCCACTGGG + Intergenic
981370415 4:143952822-143952844 CCCCACACAGAGTTCCCACTGGG + Intergenic
981380172 4:144062746-144062768 CCCCACACAGAGTTCCCACTGGG + Intergenic
982428831 4:155298500-155298522 CCCTACACAGAGTCCCCACTTGG - Intergenic
982554300 4:156840558-156840580 CCCTACAGAAAGTCCCCACTGGG + Intronic
982562307 4:156944797-156944819 CCCTACAGTGTATTCTCACTCGG + Intronic
982917194 4:161227305-161227327 CCCCACACAGAGTTCCCACTGGG - Intergenic
983075156 4:163316905-163316927 CCCTACACAGAGTCCCCACTGGG - Intergenic
983351504 4:166596687-166596709 CCCAACAGAGAGTTCCCACTGGG + Intergenic
983889513 4:173016242-173016264 CCCTACACAGAGTCCCCACTGGG + Intronic
984571899 4:181404612-181404634 CCCTACACAGATTCCTTACTGGG - Intergenic
984900332 4:184580681-184580703 CCCTACACAGAGTCCCTACTGGG - Intergenic
986084840 5:4433887-4433909 CCCCACACAGAGTCCTAACTGGG - Intergenic
986322250 5:6641456-6641478 CCCTCTAGAGAGCTCTGACTTGG - Intronic
986455279 5:7912189-7912211 CCCCACAGAGAGTCCCCACTGGG - Intergenic
986680067 5:10224456-10224478 CCCCACACAGAGTCCTTACTGGG - Intergenic
987144631 5:14980542-14980564 CTCCACAGAGAGTCTTGACTTGG + Intergenic
987503702 5:18744498-18744520 CCCTAGGGAGAGTGCTCACTAGG - Intergenic
987585034 5:19843572-19843594 CCCGACATAGAGTTCCCACTGGG + Intronic
987602062 5:20084530-20084552 CCCCACACAGAGTTCCTACTGGG - Intronic
988014115 5:25530662-25530684 CCCCACAGAGAGTCCCCACTGGG + Intergenic
988040914 5:25888113-25888135 CCCCACAGAGAGTCCCCACTGGG - Intergenic
988073689 5:26325620-26325642 CCCTACAGGGAGCTCAGACCTGG - Intergenic
988142660 5:27263809-27263831 CCCCACAAAGAGTCCTCACTGGG + Intergenic
988603076 5:32657179-32657201 CCCTACACAGAGTCCACACTGGG - Intergenic
988781273 5:34524354-34524376 CCCAACAGATATTTCTGATTTGG + Intergenic
989984909 5:50686542-50686564 CCCCACACAGAGTCCTTACTGGG - Intronic
990595585 5:57309554-57309576 CCCTACACAGAGTCCCTACTGGG + Intergenic
991136279 5:63185907-63185929 CCCCACAGAGAGTCCCCACTGGG + Intergenic
991185688 5:63804090-63804112 CCCTCCAGAGAGTTCACACCAGG - Intergenic
992138121 5:73768213-73768235 CCCCACACAGAGTTCCTACTGGG + Intronic
992215867 5:74524209-74524231 CCCCACAGAGAGTTGCTACTGGG + Intergenic
993238317 5:85344948-85344970 CCCTAGACAGAGTTCTCAGTGGG + Intergenic
993890168 5:93463471-93463493 CCCCACAGAGAGTCCCCACTGGG + Intergenic
993893677 5:93505424-93505446 CCCTACAGAGAGTTCCTACTGGG - Intergenic
994253877 5:97570068-97570090 CCCCACACAGAGTCCTTACTGGG - Intergenic
994421132 5:99527189-99527211 CCCCACACAGAGTTCCCACTGGG - Intergenic
994485910 5:100387125-100387147 CCCCACACAGAGTTCCCACTGGG + Intergenic
994549172 5:101208804-101208826 CCCCACACAGAGTACTCACTGGG + Intergenic
994637656 5:102363259-102363281 CCCTACACAGAGTCCTTACTGGG - Intergenic
994878870 5:105460829-105460851 CCATACACAGAGTTTTTACTGGG - Intergenic
997397822 5:133578452-133578474 TCCCACAGAGAGTTCTGTCCAGG + Intronic
998745877 5:145259252-145259274 CCCTACACAGAGTTCCCACTGGG + Intergenic
998926044 5:147127619-147127641 CCCCACACAGAGTTCCCACTGGG - Intergenic
999451433 5:151681184-151681206 CCCTCCAGGGAGTTGGGACTCGG + Intronic
1000007749 5:157203103-157203125 CTCTCCAGAGAGGTCTGCCTTGG + Intronic
1000581062 5:163035760-163035782 CCCCACACAGAGTTCTTACAGGG + Intergenic
1000609641 5:163360054-163360076 CCCCACACAGAGTTCCTACTGGG + Intergenic
1000784664 5:165528727-165528749 CCCCACAAAGAGTCCTCACTGGG + Intergenic
1003508618 6:6760955-6760977 GTCTGTAGAGAGTTCTGACTTGG + Intergenic
1003651444 6:7964504-7964526 CCCTACAGAGAGTTCTGACTTGG - Intronic
1003720175 6:8692948-8692970 CCCCACACAGAGTCCTCACTGGG + Intergenic
1004565137 6:16789139-16789161 CCCCACACAGAGTTCTCACTGGG - Intergenic
1006884584 6:37370392-37370414 CTTTACAGAGAGTTCTGTCCTGG - Intronic
1007076247 6:39068429-39068451 CGCTACAGAGAGTCCTGACTAGG - Intronic
1009594509 6:65717064-65717086 CCCTACACAGAGTCCTTACTGGG + Intergenic
1009637601 6:66285535-66285557 CCCCACACAGAGTTCCTACTGGG + Intergenic
1009757345 6:67956609-67956631 CCCCACATAGAGTCCTCACTGGG + Intergenic
1009945900 6:70341505-70341527 CCCTACACAGAGTCCCCACTGGG - Intergenic
1010268279 6:73891878-73891900 CCCCACAAAGAGTCCTCACTGGG + Intergenic
1010735833 6:79443005-79443027 CCCCACACAGAGTTCCTACTGGG - Intergenic
1011461929 6:87613999-87614021 CCCCACACAGAGTCCTTACTGGG - Intronic
1012762299 6:103317658-103317680 CCCCACTGAGAGTTCCCACTGGG + Intergenic
1012825322 6:104139908-104139930 CCCCACAGAGAGTCCCCACTGGG - Intergenic
1013151159 6:107447762-107447784 CCCCACACAGAGTTCCCACTGGG - Intronic
1013717217 6:112976259-112976281 CCCCACACAGAGTTCCTACTGGG + Intergenic
1013918190 6:115366938-115366960 CCCCACACAGAGTCCTTACTGGG + Intergenic
1014042982 6:116850930-116850952 CCCTACACAGAGTCCCCACTGGG + Intergenic
1014247453 6:119082870-119082892 CCCTACACAGAGTCCCCACTGGG - Intronic
1014247701 6:119084647-119084669 CCCCACACAGAGTCCTCACTGGG - Intronic
1014342575 6:120228129-120228151 CCCTACACAGAGTCCCCACTGGG - Intergenic
1014714589 6:124849294-124849316 CCCCACACAGAGTCCTCACTGGG + Intergenic
1015899183 6:138047223-138047245 CCCTACACAGAGTTCCTACTGGG - Intergenic
1019329197 7:454393-454415 CCCTGGAGAGAATTCTGACTTGG - Intergenic
1020546635 7:9541131-9541153 CCCCACATAGAGTACTCACTGGG + Intergenic
1020730193 7:11870124-11870146 CCCTACACAGAGTCCCCACTGGG + Intergenic
1020782679 7:12536099-12536121 CCCCACACAGAGTCCTCACTGGG - Intergenic
1020942839 7:14562351-14562373 CCCTACACAGAGTCCCCACTGGG + Intronic
1021134461 7:16948634-16948656 CCCCACACAGAGTCCTTACTGGG + Intergenic
1021174945 7:17439874-17439896 CCCTACACAGAGTCCCCACTGGG - Intergenic
1021179296 7:17487603-17487625 CCCAGCAGAGAGCTCTCACTTGG - Intergenic
1021996571 7:26183693-26183715 CTCTACAGAGACATCTGAATGGG + Exonic
1022129154 7:27387981-27388003 CCCTTCAGAGAGTACTGAGCTGG - Intergenic
1022512607 7:30950253-30950275 CCCTGCAGAGAGTCCCCACTTGG + Intronic
1022662665 7:32381230-32381252 GCCTAGAGAGAGTGCTGGCTTGG - Intergenic
1023374337 7:39540819-39540841 ACCTAGAGAAATTTCTGACTTGG + Intergenic
1023669388 7:42560295-42560317 CCCCACACAGAGTCCTCACTGGG + Intergenic
1024438540 7:49388090-49388112 CCCCACATAGAGTTCCTACTGGG - Intergenic
1024609935 7:51055546-51055568 CCCTCCAGGGCGTTCTGACACGG - Intronic
1024839970 7:53574610-53574632 CCCTCCTCAGAGTTCTGACTAGG - Intergenic
1024865798 7:53904173-53904195 CCCAACATAGAGTCCTCACTGGG - Intergenic
1025285802 7:57659767-57659789 CCCTACACAGAGTCCCTACTGGG + Intergenic
1025300349 7:57814997-57815019 CCCTACACAGAGTCCCTACTGGG - Intergenic
1026217139 7:68359581-68359603 TCCTAGACAGAATTCTGACTAGG - Intergenic
1027180327 7:75934965-75934987 CCCCATACAGAGTTCTCACTGGG + Intronic
1027458625 7:78424456-78424478 CCCTGCACAGAGTCCTTACTGGG + Intronic
1028066540 7:86391700-86391722 CCCTACACAGAGTCCCCACTGGG - Intergenic
1028606936 7:92665154-92665176 AACTACAGACAGTTCTAACTAGG + Intronic
1028668329 7:93372280-93372302 CCCTACACAGAGTCCCTACTGGG - Intergenic
1028957801 7:96713304-96713326 CCCCACACAGAGTTCCCACTGGG + Intergenic
1029222028 7:98998014-98998036 CCCTCCAAAGAGGACTGACTTGG + Intronic
1029452049 7:100646830-100646852 CCCTGCAGAGAGAGGTGACTGGG + Exonic
1030829838 7:114207989-114208011 CCCCACACAGAGTTCCTACTTGG + Intronic
1030834487 7:114265605-114265627 CCCCACACAGAGTACTCACTAGG - Intronic
1030930871 7:115522016-115522038 CCCTACACAGAGTCCCCACTAGG - Intergenic
1031284194 7:119843359-119843381 CCCCACACAGAGTCCTCACTGGG + Intergenic
1031290540 7:119928667-119928689 CCCCACACAGAGTTCCTACTGGG + Intergenic
1031299216 7:120042831-120042853 CCCTACACAGAGTCCCTACTGGG + Intergenic
1031330366 7:120456808-120456830 CCCCACACAGAGTCCTCACTGGG - Intronic
1031725293 7:125230337-125230359 CCCCACAGAGAGTCCCCACTGGG - Intergenic
1031807641 7:126327409-126327431 CCCGACACAGAGTTCTCACTGGG + Intergenic
1031978453 7:128108287-128108309 CCCTGCAGGCAGATCTGACTGGG - Intergenic
1032777628 7:135130198-135130220 TCCTCCAGAGAGAACTGACTTGG - Intronic
1033686911 7:143648525-143648547 CCCTACGGAGAGTCCAGATTTGG - Intronic
1033688822 7:143718791-143718813 CCCTACGGAGAGTCCAGATTTGG + Intronic
1033697699 7:143809098-143809120 CCCTACGGAGAGTCCAGATTTGG + Intergenic
1033777574 7:144629588-144629610 CCACACACAGAGTTCTGACTGGG + Intronic
1034011203 7:147531277-147531299 CCCCACACAGAGTCCTAACTGGG - Intronic
1034040716 7:147874213-147874235 CCCCACACAGAGTTCCCACTGGG - Intronic
1035294710 7:157860295-157860317 CCCTAGAGAGAGTCTTGGCTTGG - Intronic
1036086174 8:5615649-5615671 CCTTACAAAGAGGTCTGTCTTGG - Intergenic
1036940847 8:13050272-13050294 CCCCAGAGAGAGTTGTGAGTGGG + Intergenic
1037048853 8:14343251-14343273 CCCCACACAGAGTTCCTACTGGG + Intronic
1040800195 8:51331477-51331499 CCCTCCCCAGAGTTCTGGCTAGG - Intronic
1040823379 8:51590317-51590339 CTCCACAGAGAGTGCTCACTAGG + Intronic
1041075006 8:54161303-54161325 CCCGACAGAGAGTCCATACTGGG + Intergenic
1041902470 8:62997038-62997060 CCCCACACAGAGTCCTCACTGGG - Intronic
1042428168 8:68673124-68673146 GCCCACAGAGAGTACTGCCTGGG - Intronic
1043065704 8:75567745-75567767 CCCCACACAGAGTTCCCACTGGG - Intergenic
1043080626 8:75760915-75760937 CCCCACACAGAGTTCCTACTGGG + Intergenic
1043518579 8:81019753-81019775 CCCTACACAGAGTTCCCACTGGG + Intronic
1044496788 8:92896416-92896438 CACTGCAGAGAGCCCTGACTAGG + Intronic
1044945390 8:97384423-97384445 CCCTACACAGAGTTCTCAGTGGG - Intergenic
1045185163 8:99830363-99830385 GCCTCCAGAAAGTTCGGACTGGG - Intronic
1045682640 8:104679174-104679196 CCCAACAGAGAGTTCCCACAAGG - Intronic
1046052869 8:109044534-109044556 CCCCACACAGAGTCCTTACTGGG - Intergenic
1046305321 8:112357876-112357898 CCCTACACAGAGTCCCTACTGGG + Intronic
1046495616 8:115010179-115010201 CCCCCCACAGAGTTCTTACTGGG - Intergenic
1046668825 8:117035614-117035636 CCCCACACAGAGTCCTCACTGGG - Intronic
1046863172 8:119117487-119117509 CCCAACACAGAGTCCTCACTAGG - Intergenic
1047565611 8:126040657-126040679 CCCCACACAGAGTTCCTACTGGG + Intergenic
1047586926 8:126283023-126283045 CCCCACACAGAGTCCTCACTGGG + Intergenic
1048189232 8:132273104-132273126 CCCCACATAGAGTTCCTACTGGG - Intronic
1049085736 8:140477300-140477322 CCCCACACAGAGTTCCTACTGGG - Intergenic
1050905134 9:10994020-10994042 CCCTACACAGAGTCCCTACTGGG + Intergenic
1050939359 9:11439774-11439796 CCCCACACAGAGTTCCCACTGGG + Intergenic
1051990362 9:23145389-23145411 CCCCACACAGAGTCCTGACTGGG - Intergenic
1052079047 9:24180424-24180446 CCCTACACAGAGTTCCCGCTGGG - Intergenic
1052093427 9:24357010-24357032 CCCTACACAGAGTCCCTACTGGG - Intergenic
1052382757 9:27789355-27789377 CCCTACACAGAGTCCCCACTGGG + Intergenic
1052540940 9:29810842-29810864 CCCTACACAGGGTCCTCACTGGG + Intergenic
1052614547 9:30821389-30821411 CCCCACACAGAGTTCCTACTAGG + Intergenic
1053571975 9:39318979-39319001 CCCCACACAGAGTCCTCACTGGG + Intergenic
1053780307 9:41600183-41600205 CCCCACAGAGAGTCCCTACTGGG + Intergenic
1053793463 9:41703690-41703712 CCCTATACAGAGTCCTTACTGGG + Intergenic
1053882630 9:42611367-42611389 CCCCACACAGAGTCCTCACTGGG - Intergenic
1053890039 9:42682935-42682957 CCCCACACAGAGTCCTCACTGGG + Intergenic
1054093529 9:60877690-60877712 CCCCACACAGAGTCCTCACTGGG + Intergenic
1054115012 9:61153610-61153632 CCCCACACAGAGTCCTCACTGGG + Intergenic
1054125170 9:61300032-61300054 CCCCACACAGAGTCCTCACTGGG - Intergenic
1054151712 9:61611140-61611162 CCCTATACAGAGTCCTTACTGGG - Intergenic
1054168249 9:61810340-61810362 CCCCACAGAGAGTCCCTACTGGG + Intergenic
1054181873 9:61915705-61915727 CCCTATACAGAGTCCTTACTGGG + Intergenic
1054221657 9:62418835-62418857 CCCCACACAGAGTCCTCACTGGG - Intergenic
1054229057 9:62490338-62490360 CCCCACACAGAGTCCTCACTGGG + Intergenic
1054592744 9:67028924-67028946 CCCCACACAGAGTCCTCACTGGG - Intergenic
1054669279 9:67770478-67770500 CCCCACAGAGAGTCCCTACTGGG - Intergenic
1054897316 9:70328731-70328753 CCCTACACAGAGTCCCCACTGGG - Intronic
1055878499 9:80970903-80970925 CCCTACACAGAGTCCCTACTGGG + Intergenic
1057325684 9:94061441-94061463 CCCTACACAGAGTCCCCACTGGG - Intronic
1057332530 9:94129124-94129146 CCCCACACAGAGTCCTTACTGGG + Intergenic
1058307712 9:103463970-103463992 CCCCACAGAGAGTCCCCACTGGG - Intergenic
1059195744 9:112369185-112369207 CCCTACACAGAGTCCCCACTGGG + Intergenic
1059513973 9:114875872-114875894 CCCTACACAGAGTCCCCACTGGG - Intergenic
1059741723 9:117157545-117157567 CCAGACAGATAGATCTGACTTGG - Intronic
1060900459 9:127253162-127253184 CCCTACAGAAAGTTATGAACTGG + Intronic
1061347263 9:130036722-130036744 CCCTTCAGAGATTTCTGTTTGGG - Intronic
1061844322 9:133378388-133378410 CTCTGCACAGAGTTCTGGCTTGG + Intronic
1186266610 X:7840482-7840504 CCCCACACAGAGTTCCTACTAGG - Intergenic
1186620412 X:11235040-11235062 CCCCACAGAGAGTCCCCACTGGG - Intronic
1187639631 X:21274025-21274047 CCCCACACAGAGTTCCTACTGGG - Intergenic
1187734419 X:22289729-22289751 CCCCACACAGAGTTCCCACTGGG + Intergenic
1188124488 X:26351218-26351240 CCCCACACAGAGTCCTCACTGGG - Intergenic
1188807824 X:34613630-34613652 CCCTACACAGAGTCCCCACTGGG - Intergenic
1188873107 X:35398392-35398414 CCCCACACAGAGTTCTCACTGGG - Intergenic
1188900111 X:35721812-35721834 CCTTACAGAGTCTTCTGCCTGGG - Intergenic
1188964755 X:36537310-36537332 CCCCATGGAGAGTTCTCACTGGG + Intergenic
1191188597 X:57640372-57640394 CCCCACACAGAGCTCTTACTGGG + Intergenic
1191595901 X:62943919-62943941 CCCTACACAGAGTCCTCATTGGG - Intergenic
1192066638 X:67891840-67891862 CCCCACAGAGAGTCCCCACTGGG + Intergenic
1192955302 X:76063776-76063798 CCCCACACAGAGTCCTTACTGGG - Intergenic
1193058741 X:77182098-77182120 CCCCACACAGAGTTCCCACTGGG + Intergenic
1193346653 X:80411934-80411956 CCCCACACAGAGTCCTTACTGGG - Intronic
1193471277 X:81907228-81907250 CCCTACAGAGAGTGCACACTGGG - Intergenic
1193503529 X:82310062-82310084 CCCCACACAGAGTTCCTACTAGG - Intergenic
1193509112 X:82377853-82377875 CCCTACACAGAGTCCCCACTTGG - Intergenic
1193520044 X:82518702-82518724 CCCCACACAGAGTCCTCACTGGG - Intergenic
1193682713 X:84541613-84541635 CCCCACACAGAGTTCCCACTGGG + Intergenic
1193682758 X:84541858-84541880 CCCCACACAGAGTTCCCACTGGG + Intergenic
1194084153 X:89505604-89505626 CCCGACATAGAGTCCTCACTGGG - Intergenic
1194149786 X:90309767-90309789 CCCTACACAGAGTCCCCACTTGG - Intergenic
1194339788 X:92694036-92694058 CCCTACACAGAGTACCCACTGGG - Intergenic
1194418128 X:93638132-93638154 CCCTACACAGAGTCCCCACTGGG + Intergenic
1194922243 X:99780495-99780517 CCTCACAGAGAGTTTCGACTAGG - Intergenic
1195243121 X:102972742-102972764 CCCCACAGGGAGTTCCAACTGGG + Intergenic
1195510931 X:105714278-105714300 CCATAAAGAGAATTCTGACAAGG - Intronic
1196525973 X:116727388-116727410 CCCTACACAGAGTGCCAACTGGG + Intergenic
1196543322 X:116934658-116934680 CCCCACACAGAGTCCTTACTGGG + Intergenic
1196566038 X:117206440-117206462 CCCCACACAGAGTCCTTACTGGG - Intergenic
1197160536 X:123317834-123317856 CCCTACACAGAGTCCCTACTGGG - Intronic
1197223166 X:123932573-123932595 CCCCACACAGAGTTCCCACTGGG + Intergenic
1197510196 X:127361578-127361600 CCCCACACAGAGTTCCTACTGGG - Intergenic
1197992029 X:132328830-132328852 CACTACAGAGAGTCCCCACTAGG - Intergenic
1198946858 X:142025567-142025589 CCCTGCATAGAGTTCCCACTGGG + Intergenic
1198947023 X:142026878-142026900 CCCTACACAAAGTTCCCACTGGG - Intergenic
1198996391 X:142578522-142578544 CCCAACACAGAGTTCCCACTGGG + Intergenic
1199113252 X:143959313-143959335 CCCCACACAGAGTTCCTACTGGG - Intergenic
1199155001 X:144536715-144536737 CCCTACACAGAGTCCCTACTGGG - Intergenic
1199418243 X:147611927-147611949 CCCAGCAGAGTGTTTTGACTGGG + Intergenic
1199999342 X:153049619-153049641 CCCAACACAGAGTTCCCACTGGG + Intergenic
1200041693 X:153375505-153375527 CCCTACCCAAAGTTCTCACTGGG - Intergenic
1200436796 Y:3161490-3161512 CCCGACATAGAGTCCTCACTGGG - Intergenic
1200496161 Y:3886501-3886523 CCCTACACAGAGTCCCCACTTGG - Intergenic
1200648171 Y:5810819-5810841 CCCTACACAGAGTACCCACTGGG - Intergenic
1201368395 Y:13234410-13234432 CCCTTCAGAGAGTCCAGACCTGG - Intergenic
1201452281 Y:14129337-14129359 CCCTACACAGAGTCCCTACTGGG + Intergenic