ID: 1003651447

View in Genome Browser
Species Human (GRCh38)
Location 6:7964517-7964539
Sequence CTCTGTAGGGTGAAGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003651444_1003651447 -10 Left 1003651444 6:7964504-7964526 CCAAGTCAGAACTCTCTGTAGGG 0: 1
1: 0
2: 4
3: 44
4: 527
Right 1003651447 6:7964517-7964539 CTCTGTAGGGTGAAGGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003651447 Original CRISPR CTCTGTAGGGTGAAGGTGAA TGG Intronic
No off target data available for this crispr