ID: 1003652699

View in Genome Browser
Species Human (GRCh38)
Location 6:7975988-7976010
Sequence CTGCCTCTCAGCACCTGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003652695_1003652699 -5 Left 1003652695 6:7975970-7975992 CCAAGCAGCAGCAAAGCCCTGCC 0: 1
1: 0
2: 5
3: 29
4: 300
Right 1003652699 6:7975988-7976010 CTGCCTCTCAGCACCTGCGTGGG 0: 1
1: 0
2: 1
3: 24
4: 197
1003652694_1003652699 4 Left 1003652694 6:7975961-7975983 CCACAGCAACCAAGCAGCAGCAA 0: 1
1: 0
2: 1
3: 46
4: 437
Right 1003652699 6:7975988-7976010 CTGCCTCTCAGCACCTGCGTGGG 0: 1
1: 0
2: 1
3: 24
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003652699 Original CRISPR CTGCCTCTCAGCACCTGCGT GGG Intronic
900129693 1:1082111-1082133 CTGCCTCACTGCACCTGCCAAGG - Exonic
902328958 1:15721137-15721159 CTGCCTCTCAGCTCAGGCGCTGG - Intronic
903180756 1:21603664-21603686 ATGGCACTCAGCACCTGCTTTGG - Intronic
905031015 1:34884743-34884765 CTGCCTCTGAGCACCTGGGGTGG + Intronic
906481916 1:46204617-46204639 CAGCCTCTCAGCTCAGGCGTCGG - Intronic
906855019 1:49294747-49294769 CTGAGTCTCAGAACATGCGTAGG - Intronic
911409805 1:97488884-97488906 CTGCCTCTCAGCTGCTGCTCTGG + Intronic
914855264 1:151346101-151346123 CTGCCTCTCAGCAAGGGCATGGG - Intronic
915106353 1:153537142-153537164 CAGACTCCCAGCACCTGCGATGG + Exonic
915508464 1:156372225-156372247 CTCACTCTCAGCATCTGAGTGGG - Intronic
917536117 1:175875908-175875930 CTGACTCACAGCATCTGAGTTGG - Intergenic
921919466 1:220650174-220650196 CTGCCTTTCTTCACCTGCTTGGG - Intronic
924441557 1:244089708-244089730 GCGCCTCTCAGCAGCTGCCTTGG - Intergenic
1062797160 10:353134-353156 CTGCCTCCCAGCACTTCTGTGGG - Intronic
1063140127 10:3248780-3248802 ATGCCTCTGAGCTGCTGCGTTGG + Intergenic
1063207533 10:3848519-3848541 CTGCCTTTCAGCAGCTTTGTTGG + Intergenic
1065109010 10:22421890-22421912 CTTCATCTCAGAACCTGGGTTGG + Intronic
1066193658 10:33078410-33078432 CTCCCTCTCAGCACCTACAATGG - Intergenic
1067563085 10:47317585-47317607 CTGCCTTTTAGTACCTGCCTAGG - Intergenic
1072249972 10:93573671-93573693 CTGCCTCTCAGTTCATGTGTGGG + Intronic
1073444056 10:103570552-103570574 CTGCCTCTCACCACCTACCATGG - Intronic
1074123855 10:110512818-110512840 TAGCCACTCAGCACCTGCATAGG - Intergenic
1077081365 11:726034-726056 CCGCCTCCCAGCACCTGCCCGGG - Intronic
1077170986 11:1165611-1165633 CTTGCTCTCAGCACCTGCTCCGG + Exonic
1081909993 11:46694523-46694545 CTGCCCCTCCCCACCTCCGTGGG - Intronic
1082004548 11:47412337-47412359 CTGCCCCTCACCACCTGCAGGGG - Exonic
1083262535 11:61531016-61531038 CTGCCCCTCAGCTCCTTCTTTGG + Intronic
1083736539 11:64684890-64684912 AGGACTCTGAGCACCTGCGTGGG + Intronic
1083966984 11:66049136-66049158 TTGCCTCTCAGCGCCTGGATGGG + Exonic
1084186149 11:67472912-67472934 CTGCCTCTGAGCAGCTGCTGGGG - Intergenic
1084500367 11:69531479-69531501 CTGCCTGTCTGCACCTGCCTGGG + Intergenic
1085885752 11:80519764-80519786 CTGACTGTCAGCATCAGCGTGGG - Intergenic
1088648306 11:111935860-111935882 CTGCCACTCAACACCTGTGCTGG + Intronic
1091278741 11:134370144-134370166 CTAGCTCTCAGCACCTGCTGAGG - Intronic
1091742562 12:2970351-2970373 CTGCCACTTAACACCTGGGTGGG + Intronic
1094835751 12:34321278-34321300 CTTCCTAGCAGCCCCTGCGTGGG - Intergenic
1096266312 12:50125499-50125521 CTTCCTTTCACCACCTGGGTGGG + Intergenic
1101355750 12:103975981-103976003 CTACCTCTCAACACTTGCATTGG + Intronic
1102947439 12:117001969-117001991 CTCTCTCTCAGCACGTCCGTAGG - Intronic
1103698522 12:122835572-122835594 CTGCGGCTCAGCACCCGCGCCGG - Exonic
1103931095 12:124451492-124451514 CCGCCTCTCAGCCCCAGCGCTGG + Intronic
1105854641 13:24362687-24362709 TTCCCTCTAAGCACCTCCGTGGG + Intergenic
1105865128 13:24452231-24452253 CTGAGTCTCAGAACCTGGGTTGG - Intronic
1107630785 13:42341006-42341028 CTGCCTCTCTGTACGTGCCTGGG - Intergenic
1107717739 13:43217176-43217198 CTGCCTCTCTGGCCCTGGGTGGG + Intronic
1108690777 13:52857455-52857477 CTGGCTCTGAGCTCCTGCTTTGG + Intergenic
1120723912 14:87916731-87916753 CTGAATCTCAGCACCTGCACTGG - Intronic
1121794264 14:96722513-96722535 GTGACTCTCAGCATCTGAGTTGG - Intergenic
1122305775 14:100765509-100765531 ATGCCTATTAGCACCTGCGCAGG - Intergenic
1122942935 14:104990879-104990901 ATGCCTCACAGCACCTGCCCTGG - Intronic
1124598723 15:31113309-31113331 CTGCCTCTGAGCCCCTGACTGGG + Intronic
1129105559 15:73304990-73305012 CTGCCGCTCAGCAGCTTCCTCGG + Exonic
1129315703 15:74742434-74742456 CTGCATGCCAGCCCCTGCGTTGG + Intergenic
1131298240 15:91171448-91171470 CTGCCTCTCTGCTGCTGCGGTGG + Intronic
1131811700 15:96180094-96180116 CTGCCTCTTTGCCCCTGCCTCGG + Intergenic
1132541974 16:514400-514422 AGGACTCCCAGCACCTGCGTCGG + Intronic
1132704373 16:1236847-1236869 CTTCCTCCCAGCGCCTGCCTCGG - Intergenic
1132707143 16:1249578-1249600 CTTCCTCCCAGCGCCTGCCTCGG + Intergenic
1132710714 16:1265911-1265933 CTGCCTCCCGGCAGCTGGGTGGG - Intergenic
1133922226 16:10163608-10163630 CTGCCACTCAGCCCCTCCCTTGG + Intronic
1134524354 16:14932765-14932787 CTGCCCCTCTGCCCCTGCATTGG + Intronic
1134548547 16:15128176-15128198 CTGCCCCTCTGCCCCCGCGTTGG - Intronic
1134711943 16:16331252-16331274 CTGCCCCTCTGCCCCTGCATTGG + Intergenic
1134954885 16:18377442-18377464 CTGCCCCTCTGCCCCTGCATTGG - Intergenic
1135653749 16:24229583-24229605 CTGCCTCTCAGGGGCTGAGTTGG + Intergenic
1136233712 16:28902456-28902478 GACCCTCTCAGCACCTGCATGGG - Intronic
1136609582 16:31358072-31358094 GTGCCTTCCAGCACCTCCGTGGG + Intronic
1138185044 16:54970416-54970438 CTGCCACTCAGCTCATGCTTGGG + Intergenic
1140643336 16:77002655-77002677 CTGCCTCTCAGCAGGTGGATGGG - Intergenic
1142030792 16:87837550-87837572 CTGGCTCACTGCACCTCCGTGGG - Intronic
1142257279 16:89020139-89020161 CTGCCTCTCAGCGTCTACATGGG - Intergenic
1142290043 16:89189843-89189865 CTGCCTCTAAACTGCTGCGTCGG - Intronic
1144890564 17:18491721-18491743 CTGCCCCTCAGCCCCTCCGCAGG - Intronic
1145141654 17:20452597-20452619 CTGCCCCTCAGCCCCTCCGCAGG + Intronic
1146938500 17:36827140-36827162 CTGCCTCTCTCCACCTGGGAAGG - Intergenic
1147561792 17:41513833-41513855 CTGCCTCTCCCCACCTTCTTTGG - Exonic
1148187859 17:45657536-45657558 GGGCCTCTGAGCACCTGTGTAGG + Intergenic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1150636302 17:66915533-66915555 GTGCGGCTCAGGACCTGCGTGGG - Intergenic
1151534221 17:74729643-74729665 CTGCCTGGCAGGAGCTGCGTGGG + Intronic
1151980059 17:77503310-77503332 CTGGCTCTGAGCTCCTGCGTGGG + Intergenic
1152750328 17:82059601-82059623 CTCCCTCTCAGCAGCTGCTCAGG + Intronic
1153651578 18:7245623-7245645 ATACCTCTCAGCTCCTGTGTGGG - Intergenic
1154164879 18:12007169-12007191 TTGCCTCTCAGCATCTCGGTGGG + Intronic
1156305305 18:35873614-35873636 CTGCCTCTCAGCAGCTGTTAGGG - Intergenic
1157173155 18:45426820-45426842 CTGCCTCTGGGAACCTGCATTGG + Intronic
1159016486 18:63105246-63105268 CTACCTCTCAGGACCGGCCTGGG + Intergenic
1160174913 18:76585263-76585285 CATCCTCTCTGCTCCTGCGTGGG + Intergenic
1160311058 18:77790625-77790647 CTCCCTCTGAGCACCTACATTGG - Intergenic
1161572255 19:5036903-5036925 CTGCCTGTCAGCACCTGCCTGGG + Intronic
1162880430 19:13654768-13654790 CTGCCTCTGAGCTGCTGCTTTGG - Intergenic
1162911702 19:13851263-13851285 CTGGCTCACAGCACCTGCTGCGG + Intergenic
1163045886 19:14641579-14641601 CTGACTGTCATCACCTACGTGGG - Exonic
1163129962 19:15266149-15266171 CTGCCTCCCAGCAGCTGTGCAGG + Intronic
1163768381 19:19176238-19176260 CTGCCTCCCAGGACCTGCCTAGG - Intronic
1163815140 19:19460558-19460580 CTGCTCCTCAGCATCTCCGTGGG + Intronic
1166456162 19:42941786-42941808 CTGTCTCTCACCACCTGGGCAGG - Intronic
1166917512 19:46205590-46205612 CTCTCTCTCAGCACCTGAATGGG - Intergenic
925189107 2:1868694-1868716 CTGCCTCTCAGCCCCAGGGCAGG - Intronic
925325631 2:3019872-3019894 CTGCATCACAGCATCTGCTTGGG - Intergenic
928615858 2:33038935-33038957 CTGCCTCTGGGCACCTGCCTGGG + Intronic
929818752 2:45257130-45257152 AAGCCTTTCAGCACCTGGGTCGG - Intergenic
930873959 2:56193116-56193138 CTCCCACTCAGCACGTGCTTGGG - Exonic
931722585 2:65078140-65078162 CTGCCTCTAAGCAGGTGTGTAGG - Intronic
933209371 2:79549295-79549317 ATGCCTCTTAGCACATGGGTCGG + Intronic
933655139 2:84880881-84880903 CGGCCTCTCTGCACCTCCTTGGG - Intronic
934503526 2:94875838-94875860 TCCCCTCTCAGCACCTGCGGGGG - Intronic
935618396 2:105108610-105108632 ATGCCCCGCAGCACCTGCCTGGG + Intergenic
936017783 2:108972750-108972772 CTGAGTCTCAGCATCTGCATGGG - Intronic
936158860 2:110069198-110069220 CTGCCTCTGGCCACCTGTGTTGG - Intergenic
936185800 2:110302134-110302156 CTGCCTCTGGCCACCTGTGTTGG + Intergenic
936693921 2:114925490-114925512 TTCCTTCTCAGCAGCTGCGTGGG + Intronic
937871757 2:126791295-126791317 CAGCCCCTCAGCTCCTGTGTGGG + Intergenic
938314295 2:130315435-130315457 CTGCCTCTCAGCCCCTGAGCAGG - Intergenic
939629441 2:144516045-144516067 CTGCGTCCCAGCGCCTGCCTCGG + Intronic
942320237 2:174730141-174730163 CTGCATCCCATCACCTGCGTCGG - Intergenic
942728168 2:179033446-179033468 TTGTCTCTCAGTACCTGTGTGGG - Intronic
944541396 2:200757075-200757097 CTGCCTCCCTGCACCTGGGAAGG + Intergenic
945349203 2:208757594-208757616 TTGCCTGTCAGCACCTAAGTAGG - Intronic
946329531 2:219001617-219001639 CGGCCTCTCAGCACCAGCCCGGG - Intergenic
947206701 2:227667406-227667428 CTACTTCTCTGCACCTGCATGGG + Intergenic
948154575 2:235771068-235771090 GGGCCTCCCAGCACCTGCGGCGG - Intronic
948289822 2:236816688-236816710 CTGCCTCTCAGCTCCTCCCATGG + Intergenic
1168787390 20:551753-551775 TTTCCTCTGAGCACCTGCATGGG - Intergenic
1168939194 20:1694727-1694749 CAGGCTCTCAGCGCCTGAGTGGG - Intergenic
1171255873 20:23688749-23688771 CTGGCTCGCAGCACCTGCAGCGG + Exonic
1171460493 20:25295454-25295476 CTGGCTCTGACCAGCTGCGTGGG + Intronic
1172096902 20:32464888-32464910 CTGCGTCTCAGCGGCTCCGTAGG - Intronic
1172185148 20:33026980-33027002 CTGCATCTGAGCTGCTGCGTTGG - Intergenic
1172277634 20:33688557-33688579 CTCTCTGCCAGCACCTGCGTTGG - Intergenic
1172940953 20:38654355-38654377 GTGCTTCCCAGCACCTGCGGTGG + Intergenic
1174059804 20:47825045-47825067 CTGCCTCCCAGGACCTGCAGAGG + Intergenic
1175685455 20:61024835-61024857 TTGCCTCTCAGAGCCTCCGTTGG + Intergenic
1175917954 20:62436132-62436154 CTGCCTCTGAGCAGCTGCTCTGG + Intergenic
1176604155 21:8815390-8815412 CTGCCTCTCTGCGTCTGCGCCGG + Intergenic
1179106146 21:38402516-38402538 CTGCCTCCCAGCAAGAGCGTAGG - Intronic
1179913680 21:44462985-44463007 CTGCCCCTCAGCTCCTGGGGTGG + Intergenic
1180346439 22:11706968-11706990 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180354208 22:11825121-11825143 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180384038 22:12167205-12167227 CTGCCTCTCTGCGCCTGCGCCGG - Intergenic
1185199710 22:49494212-49494234 CTGCCTCTCTGCATCTGCCCTGG - Intronic
950110318 3:10414525-10414547 CTGCTTCTCAGCTCCTGTGGGGG + Intronic
950437766 3:12991071-12991093 CTCCCTCTCACCCCCTGCCTCGG - Intronic
950550874 3:13665202-13665224 CTGCATCTCAGCACCTGGGCTGG - Intergenic
953789572 3:45937065-45937087 CTGCCTCTGAGGAACTGCCTGGG - Intronic
953796821 3:45992304-45992326 CTGCCTCTCTGCACCTACGCTGG - Intronic
954813805 3:53264819-53264841 CTTCCTCTCAACACCTGCTGAGG - Intergenic
954912857 3:54122964-54122986 CTGCCTTTCGGGACCCGCGTCGG + Intronic
956249988 3:67225821-67225843 CCTCCTCTCAGCATCTGCCTTGG - Intergenic
961360739 3:126365596-126365618 CGGCCTCTCAGCACATGCTGAGG - Intergenic
964766656 3:160186070-160186092 CTACCTCTGAGAACCTGGGTAGG + Intergenic
966373276 3:179270671-179270693 CTGCCTCTCAGCAGCTGATGGGG - Intergenic
966898111 3:184461003-184461025 CTGGCTCTCAGAACCTGCAGAGG + Intronic
968471475 4:784577-784599 CTGCCCCCCAGCACCCCCGTGGG - Intergenic
968520636 4:1033304-1033326 CTGCATCTCAGCAGCTGTTTTGG + Intergenic
973176666 4:47214348-47214370 CTACCTCTCAGCTCCAGAGTGGG + Intronic
973373962 4:49275530-49275552 CTGCCTCTCTGCGCCTGCGCCGG - Intergenic
973383450 4:49334709-49334731 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
973386823 4:49518768-49518790 CTTCCCATCAGCCCCTGCGTGGG - Intergenic
973387057 4:49519723-49519745 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
980053900 4:128061892-128061914 CTGCGTCCCAGCACCAGCGCCGG - Intronic
980964479 4:139507393-139507415 CTGACTCTCAGCAACTTCCTCGG - Exonic
982214011 4:153064792-153064814 CTGGCTCTCTGCACCTACCTGGG + Intergenic
985410642 4:189679729-189679751 CTGGCTCTCAGCAACTGCTCTGG - Intergenic
985991566 5:3566058-3566080 CTGCCTCTCACCATCTGTCTGGG + Intergenic
989107867 5:37880420-37880442 CTGACTCTCACCACCTGCAGTGG + Intergenic
995417390 5:111925988-111926010 CTGCCTCTCAGCAGCTGTTAGGG + Intronic
997472811 5:134126134-134126156 CTGCCTCTCAGCATCTCAGAGGG - Intronic
997658687 5:135574023-135574045 GTGCCTTCCAGCACCTGCGAAGG + Intronic
998184653 5:139968897-139968919 CTGCGTCTCAGCTCCTGCACCGG - Intronic
1002048407 5:176554985-176555007 CTGCCTCTCAGAACTTGAGCCGG - Intronic
1003075958 6:2983860-2983882 CTTCCTCTCAGCACCAGCAGCGG - Intergenic
1003652699 6:7975988-7976010 CTGCCTCTCAGCACCTGCGTGGG + Intronic
1005527627 6:26666666-26666688 CTGCCACTCATCACCTGCTATGG + Intergenic
1007841390 6:44718757-44718779 CTCCCTCACAGAACCTTCGTGGG - Intergenic
1008628520 6:53341963-53341985 CTGCCACTTAACAGCTGCGTGGG - Intronic
1012115457 6:95291523-95291545 CAGCCACTCAGAACCTGAGTGGG - Intergenic
1012531086 6:100237272-100237294 CTGCCTCCCACCGCCTGCATTGG + Intergenic
1016368293 6:143342348-143342370 CTGCGTCTAAGCAGCTGCGGCGG - Intergenic
1017647572 6:156552997-156553019 CTGCCTCTGAGCATCTGTGAAGG + Intergenic
1018701986 6:166434475-166434497 CAGCCTCCCAGGACCTGCTTAGG - Intronic
1018983369 6:168616930-168616952 CTGTGTCCCTGCACCTGCGTGGG - Intronic
1019923213 7:4175704-4175726 CTGCCGCACATCACCTGCGATGG + Intronic
1024497869 7:50068958-50068980 CTGCTTCTCAGCACCTTTGTAGG + Intronic
1024673526 7:51617796-51617818 CTGCCTCTGAGTCCCTGCCTTGG + Intergenic
1029159922 7:98544297-98544319 CTGCCCTGCAGCACCTGGGTGGG + Intergenic
1031943904 7:127818523-127818545 CTCCCTCTCAGCCCCTGGCTTGG + Intronic
1034051272 7:147986719-147986741 CTGCCTATCAACAGCTGAGTGGG + Intronic
1034284227 7:149873875-149873897 CTGTCACTCAGGACCTGCCTAGG - Exonic
1034488531 7:151381005-151381027 CTGCCTCTCACAACCGGCCTGGG - Intronic
1035162745 7:156963018-156963040 CTGCGTCTCAGAACCTGAGCCGG - Exonic
1035418149 7:158706349-158706371 ATGCATGTCAGCACCAGCGTGGG - Intergenic
1035609434 8:950071-950093 CTGCCCGGCAGCACCTGCCTTGG + Intergenic
1035760708 8:2066653-2066675 CTGCCTCTCAGAACATGCCTGGG - Intronic
1035810271 8:2485619-2485641 CCACCTCTCAACACCTGCCTCGG + Intergenic
1038537115 8:28361129-28361151 CTGCCTCTCCTCTCCTGCGGAGG + Exonic
1039745537 8:40422823-40422845 CTGTCTCTCAGCCCCTGCCTGGG - Intergenic
1042274595 8:66990789-66990811 CTGCCTGTCATCATCTGCCTGGG + Intronic
1042418783 8:68560214-68560236 CTGTCTCTCGGCACCTCTGTAGG - Intronic
1042557145 8:70043134-70043156 CTGCATCTCAGTACGTGCATTGG + Intergenic
1044949247 8:97419222-97419244 CTGCCTCTTGGAACCTGGGTAGG - Intergenic
1047318707 8:123758259-123758281 CTTCCTTTCAGCACCAGCTTCGG + Intergenic
1047618001 8:126579141-126579163 GTGCTTCCCAGCACCTGAGTCGG - Intergenic
1053643285 9:40107485-40107507 CTGTCTCTCTGCACCTGCGCCGG - Intergenic
1053762867 9:41358005-41358027 CTGTCTCTCTGCACCTGCGCCGG + Intergenic
1054324143 9:63704714-63704736 CTGTCTCTCTGCGCCTGCGCCGG - Intergenic
1054350964 9:64016540-64016562 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054541470 9:66269118-66269140 CTGTCTCTCTGCACCTGCGCCGG + Intergenic
1055404746 9:75962805-75962827 CTGCCACTCAGCACTTCTGTGGG - Intronic
1057746925 9:97759857-97759879 CTGCTTCCCAGCCCCTGCTTGGG - Intergenic
1061395157 9:130339831-130339853 CTCCTTCTCAGAAGCTGCGTAGG + Intronic
1061978708 9:134087486-134087508 CTGGCCCTCAGCACCTGCAGAGG - Intergenic
1062271020 9:135708898-135708920 CTGCCTCTCAGGATCAGCATAGG - Intronic
1062518844 9:136949431-136949453 GTCCCTCTGAGCACCTGCGTGGG - Intronic
1203697638 Un_GL000214v1:113412-113434 GGGCCTCTCTGCACCTGCGCCGG - Intergenic
1203551562 Un_KI270743v1:167545-167567 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1203564413 Un_KI270744v1:79723-79745 TCCCCTCTCAGCACCTGCGGGGG - Intergenic
1203672120 Un_KI270755v1:25697-25719 CTGGCTCTCAGCAACTGCTCTGG + Intergenic
1187951641 X:24476518-24476540 CTGCCTCTCAGTATCTGTGGGGG - Intronic
1189244866 X:39555571-39555593 CTGCCTCTCTGCATGTGAGTAGG - Intergenic
1196805049 X:119575731-119575753 CTGCCTATCAGCAACTGGTTGGG - Intronic
1197921289 X:131597081-131597103 ATGCCTCTCAGCTCCTGGGATGG - Intergenic
1199787398 X:151117401-151117423 CTGCCTATCAGTTCCTGAGTGGG - Intergenic