ID: 1003656938

View in Genome Browser
Species Human (GRCh38)
Location 6:8020533-8020555
Sequence GATTTCCAGAGAAACTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003656938_1003656944 28 Left 1003656938 6:8020533-8020555 CCAGCTGAGTTTCTCTGGAAATC 0: 1
1: 0
2: 0
3: 12
4: 208
Right 1003656944 6:8020584-8020606 TTTGCTGGAACAAATCTGGAGGG 0: 1
1: 1
2: 5
3: 23
4: 196
1003656938_1003656941 13 Left 1003656938 6:8020533-8020555 CCAGCTGAGTTTCTCTGGAAATC 0: 1
1: 0
2: 0
3: 12
4: 208
Right 1003656941 6:8020569-8020591 TGTCACTCAACTTCATTTGCTGG 0: 1
1: 0
2: 2
3: 14
4: 153
1003656938_1003656942 24 Left 1003656938 6:8020533-8020555 CCAGCTGAGTTTCTCTGGAAATC 0: 1
1: 0
2: 0
3: 12
4: 208
Right 1003656942 6:8020580-8020602 TTCATTTGCTGGAACAAATCTGG No data
1003656938_1003656943 27 Left 1003656938 6:8020533-8020555 CCAGCTGAGTTTCTCTGGAAATC 0: 1
1: 0
2: 0
3: 12
4: 208
Right 1003656943 6:8020583-8020605 ATTTGCTGGAACAAATCTGGAGG 0: 1
1: 1
2: 3
3: 11
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003656938 Original CRISPR GATTTCCAGAGAAACTCAGC TGG (reversed) Intronic
900533135 1:3164594-3164616 GGTTTCCAGAGACACCGAGCGGG - Intronic
902187023 1:14733284-14733306 AAGTCCCAGAGAAACTTAGCTGG + Intronic
903666433 1:25010420-25010442 GAATTCGAGAGCAGCTCAGCTGG - Intergenic
908358911 1:63348570-63348592 GATTTGTAGGGAAAGTCAGCTGG - Intergenic
910840096 1:91553263-91553285 GATTGCCAGAGTGACTCAGAGGG - Intergenic
910941291 1:92537674-92537696 GATTTCCAGAGAATCAGAACAGG + Intronic
911975686 1:104491165-104491187 GATTTCCACTGAAAGTCTGCTGG - Intergenic
915850306 1:159314530-159314552 CATTGCCAGAGAGAGTCAGCAGG + Exonic
915857608 1:159406238-159406260 CATTGCCAGAGACAGTCAGCAGG + Intergenic
917970341 1:180201989-180202011 GGTGGCCAGAGAGACTCAGCCGG - Exonic
918698354 1:187574690-187574712 AATTTCCAGAAAAATTCTGCTGG - Intergenic
919038109 1:192342563-192342585 GATTTTCAGAGAATCTGAGGAGG - Intronic
921360500 1:214327109-214327131 GAGGTGCAGAGAAACTCAGACGG + Intronic
1065291834 10:24238231-24238253 GTTCTTCAGAGGAACTCAGCAGG - Intronic
1065298015 10:24294997-24295019 TATTTCCAGAGAAAAGCATCTGG - Intronic
1066607921 10:37201939-37201961 AATTTTCATAGAAAATCAGCGGG + Intronic
1067178552 10:43968056-43968078 CCTTCCCAGAGCAACTCAGCAGG - Intergenic
1068426220 10:56868004-56868026 GATCTCCAGAGAAACAAAACCGG + Intergenic
1071375101 10:84994380-84994402 GAAATTCAGAGAAAGTCAGCTGG + Intergenic
1071791858 10:88963295-88963317 TATTTCCAGAGATTCTCAGAGGG + Intronic
1071872834 10:89814257-89814279 GATTTTCAGAGAAACTTCACAGG + Intergenic
1074918362 10:117981399-117981421 GAATTGCAGAGAAACATAGCTGG - Intergenic
1075040008 10:119100581-119100603 GATATCCATAGAAAGTCTGCTGG + Intergenic
1076559557 10:131352474-131352496 GCTTTGCAGAGTAACACAGCAGG + Intergenic
1078400409 11:11021290-11021312 GCTTTCCAGGCAAACTCCGCAGG + Intergenic
1079091698 11:17485211-17485233 GGCTTACAGAGAAACCCAGCTGG - Intergenic
1079995114 11:27287470-27287492 CATTTCCAGTGTAAGTCAGCTGG - Intergenic
1081170345 11:39861351-39861373 AGTTTTCAGAGATACTCAGCTGG + Intergenic
1081539991 11:44027462-44027484 AATTTTCATAGGAACTCAGCTGG - Intergenic
1081631855 11:44694717-44694739 AATTTACAGAGAAGCCCAGCTGG - Intergenic
1082023515 11:47553857-47553879 GGATTCCAGAGTAACTCAGGAGG - Intronic
1083816802 11:65137362-65137384 GAATTCTAGAGACACTCAGGAGG - Intergenic
1084765517 11:71305719-71305741 GCTTTCCAGGCAAATTCAGCAGG + Intergenic
1086395723 11:86413191-86413213 GATGTCCAGAGCACATCAGCAGG - Intronic
1088744845 11:112796668-112796690 GAGTTCCAGTAAAACTCAGGTGG - Intergenic
1089644252 11:119867912-119867934 GATTTTCCCAGAAACTCTGCAGG - Intergenic
1096416432 12:51418268-51418290 GATATCCAGGGAAAATCAGATGG + Intronic
1099790964 12:87332928-87332950 AAGTTCCTGAGAAAGTCAGCTGG + Intergenic
1100433204 12:94548681-94548703 CATTTCCAGAGAAACCTACCTGG + Intergenic
1101682890 12:106986844-106986866 CTTTTCCAGAGAAACCCGGCAGG + Exonic
1104269079 12:127266110-127266132 CATTTCCATGGAAACTCTGCAGG + Intergenic
1105033935 12:132904765-132904787 GCTTCCCAGAGGAACTCTGCCGG - Intronic
1105989005 13:25599662-25599684 GAATTCCAGGGAAACTTAGCTGG + Intronic
1106020024 13:25905627-25905649 CACTTCCAGAGAAACCCAGATGG - Intronic
1109140153 13:58704523-58704545 GGTTTTCAGATATACTCAGCAGG + Intergenic
1110613524 13:77515711-77515733 CAGTTCCAGAAAAACTCAGGTGG + Intergenic
1115769973 14:36658097-36658119 CAGTTTCAGGGAAACTCAGCTGG + Intronic
1119227256 14:72954007-72954029 GGTTGCAAGAGAGACTCAGCTGG - Intronic
1119790367 14:77344563-77344585 GATTTGAAGGGAAACTCACCAGG - Intronic
1121701491 14:95957955-95957977 CAATTCCAGAGAAACTCTCCAGG + Intergenic
1122731543 14:103802987-103803009 GCTTTCTAGAGAAATTAAGCTGG + Intronic
1122797563 14:104213672-104213694 GTTTTCCAGAAAAACACATCGGG - Intergenic
1124008459 15:25813486-25813508 GATTTCCAGTGAAAAAAAGCAGG + Intronic
1124722476 15:32121938-32121960 GATTTCCAGAGAAGTCCAGTTGG - Intronic
1127324818 15:57884700-57884722 CATTCCCACAGTAACTCAGCTGG - Intergenic
1130371762 15:83290651-83290673 GAATTGTAGAGAAATTCAGCTGG + Intergenic
1130875204 15:88007784-88007806 GATTGCCCAAGAAACACAGCTGG - Intronic
1133389359 16:5396874-5396896 GATTTATAGAGATTCTCAGCTGG + Intergenic
1134095376 16:11415247-11415269 GCTATACAGAGAAACTCATCGGG + Intronic
1134316980 16:13127608-13127630 GACAGCCAGAGAAACTCTGCAGG - Intronic
1137022404 16:35441696-35441718 TTTGTCAAGAGAAACTCAGCAGG - Intergenic
1140276221 16:73511347-73511369 GATTTCCCTAGAAACAGAGCAGG - Intergenic
1142026829 16:87818900-87818922 GAGATCCTGAGAAACTCAGCAGG - Intergenic
1144182099 17:12762043-12762065 GTTTTCTGGAGAAACACAGCTGG + Intronic
1150440051 17:65183746-65183768 TATCTGCAGAGAAACTCAGGTGG - Intronic
1151000689 17:70372129-70372151 AATCTCCAGTGATACTCAGCAGG - Intergenic
1151278430 17:73053930-73053952 GATTTCCGTATAGACTCAGCAGG + Intronic
1151971879 17:77461789-77461811 GATTGGCAGAGTAAATCAGCAGG + Intronic
1152885794 17:82848532-82848554 GTTTTCCAGAGCAACTCATGTGG + Intronic
1153638880 18:7137700-7137722 GATTTACAGAAAAAGTAAGCAGG + Intergenic
1157939170 18:51908053-51908075 GATTTCCAGAGAAATGAAGCAGG + Intergenic
1158025589 18:52893287-52893309 TATTGCCAGAGAATCTCAGCAGG + Intronic
1159720351 18:71882385-71882407 GTGTTCCTGAGAAACTCAGAGGG - Intergenic
1160279205 18:77471358-77471380 GGATTCCAGAGAAAATCAGAGGG - Intergenic
1160848510 19:1177934-1177956 GATTTCCAGGGAATCACAGGGGG + Intronic
1161692358 19:5743750-5743772 GATTTCCATAGCAGCCCAGCTGG - Intronic
1162648478 19:12067036-12067058 GATTTCCATAAAAAATTAGCTGG + Intronic
1163267489 19:16229619-16229641 CATTTCCAGCTTAACTCAGCTGG - Intronic
1163352898 19:16790201-16790223 GAGTTCCCAAGAAACTCAACTGG - Intronic
1163685472 19:18709631-18709653 GCTTCCCAGAGGACCTCAGCAGG - Intronic
1164185246 19:22861330-22861352 GTTTTCCAGAGAAAATGACCAGG - Intergenic
1165247568 19:34505922-34505944 GATTTCCAGGCATCCTCAGCGGG + Exonic
1166585285 19:43941113-43941135 GATTTACAGAAAAATTGAGCAGG + Intergenic
925520864 2:4743723-4743745 GATTTACAGAAAAACTGAGAGGG - Intergenic
926682478 2:15674527-15674549 GTTTGCCACAGAAACACAGCAGG + Intergenic
927950773 2:27167421-27167443 GATGTTCAGAGAAACTCTCCTGG + Intergenic
928240167 2:29579103-29579125 GATTTCCAGACCCATTCAGCAGG - Intronic
928953639 2:36838369-36838391 GAACTCCAGGGAAACTCAACTGG - Intergenic
929735827 2:44548280-44548302 GATTCACAGAGAAACACAGAAGG - Intronic
930003092 2:46874461-46874483 GACACCCAGAGAAACTGAGCGGG + Intergenic
930335337 2:50038585-50038607 GAATCCCAGAAAAACTTAGCTGG - Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
933008511 2:77025844-77025866 TATTTCCACATATACTCAGCAGG + Intronic
934779937 2:96963516-96963538 GAGTTCCAGGGAAAGGCAGCCGG - Intronic
935500613 2:103834024-103834046 GCTTTCCTGAAAATCTCAGCTGG - Intergenic
938813377 2:134874195-134874217 GACCTCCAGAAAAACTCAGCAGG + Intronic
939149553 2:138456633-138456655 GCTTTCAAGAGAACATCAGCTGG - Intergenic
940488703 2:154329507-154329529 GATGTCCAGAGAAACCGAACTGG - Intronic
943240810 2:185381229-185381251 GATTTTCAGAGAAAGTCTGAAGG - Intergenic
943541635 2:189222637-189222659 GATCTTCAGAGAAACTAGGCTGG + Intergenic
945099020 2:206246747-206246769 GAATTAAAGAGAAAATCAGCCGG - Intergenic
946536902 2:220640118-220640140 GAATTCCAGAGAACCGCAGAGGG + Intergenic
946676663 2:222167722-222167744 AGTTTCCAGAGGAACTCTGCTGG + Intergenic
1169632782 20:7651661-7651683 GATTTCAAAATAAACTCATCAGG - Intergenic
1169663011 20:8001006-8001028 GAATTCCAGAGATACTTAGGAGG - Intronic
1169755952 20:9043434-9043456 TATTTCAAGAGAAAAGCAGCCGG + Intergenic
1169925732 20:10782097-10782119 GAGTTCCAGAGTGCCTCAGCAGG - Intergenic
1171754637 20:29091928-29091950 GATTTCCAAAGATACTCTTCTGG - Intergenic
1171788018 20:29490614-29490636 GATTTCCAAAGATACTCTTCTGG + Intergenic
1171859921 20:30388787-30388809 GATTTCCAAAGATACTCTTCTGG - Intronic
1172674167 20:36655629-36655651 GATTTGCATTTAAACTCAGCTGG - Intronic
1173023185 20:39284857-39284879 CATTTCTAGGGAAACTCAACAGG + Intergenic
1176371375 21:6063823-6063845 GGTTTGCAGAAAAACTGAGCAGG + Intergenic
1178679970 21:34665805-34665827 GATTTCCAAAGAGGATCAGCTGG + Intergenic
1179069872 21:38061295-38061317 GATGTGCAGAGAAAGTCAGAGGG + Intronic
1179304199 21:40140056-40140078 GATTCCCACAGACACTGAGCAGG - Intronic
1179752144 21:43474716-43474738 GGTTTGCAGAAAAACTGAGCAGG - Intergenic
1180296980 22:10949819-10949841 GATTTCCAAAGATACTCTTCTGG + Intergenic
1182683055 22:32097519-32097541 GACTTGAAGTGAAACTCAGCAGG + Intronic
1182921141 22:34080659-34080681 GAGTTCCTTAAAAACTCAGCAGG - Intergenic
1183046677 22:35226175-35226197 GGCTTCCAGAGACACTCAGCGGG - Intergenic
1184831289 22:46990366-46990388 GCTTTCCAGAAAAATTGAGCAGG + Intronic
950392321 3:12706372-12706394 GGTTTCCTGAGAAACTGAGGAGG + Intergenic
950755149 3:15164620-15164642 GAATTGCAGAGCAACTCTGCTGG - Intergenic
951195582 3:19819735-19819757 TATTACCAGAGCAATTCAGCTGG + Intergenic
952164952 3:30737778-30737800 GATTTTCAGATATACTCAGGAGG - Intronic
954914356 3:54136046-54136068 GATTTCCAGTGGAGATCAGCTGG - Intronic
955597500 3:60607503-60607525 TATTTTCAGAGCAACTCATCAGG + Intronic
956277678 3:67520589-67520611 TATTTCCAGAGAAACCTACCTGG - Exonic
956927926 3:74009425-74009447 CATTGCAAAAGAAACTCAGCAGG + Intergenic
958640881 3:96802912-96802934 AATTTCAACAGAAAATCAGCAGG + Intergenic
959556918 3:107730395-107730417 GATGACCAAAGAAAATCAGCTGG - Intronic
962241386 3:133753936-133753958 GCTTATCAGAGAAACACAGCAGG + Intronic
964454817 3:156851367-156851389 GATTTCCTGAGAGACACAACTGG + Intronic
966807054 3:183815966-183815988 CATTTCCACAGACACCCAGCAGG + Exonic
968528892 4:1079606-1079628 GGTATACAGAGGAACTCAGCAGG + Intronic
970013826 4:11490398-11490420 CATTGGAAGAGAAACTCAGCAGG - Intergenic
972967471 4:44529214-44529236 CATTTCCTGAGAAACTCACAAGG - Intergenic
973846443 4:54917823-54917845 GATTTAGAGAGAAACCCAGAGGG - Intergenic
974396158 4:61337565-61337587 GATTTCAAGAAAAACTAAACAGG - Intronic
974634479 4:64542095-64542117 GCTTTCCAGAGAAAAAAAGCAGG - Intergenic
976870341 4:89785081-89785103 GAATTCCAGAGATTCTCAGATGG + Intronic
978096519 4:104785452-104785474 AATTTGCAGAGAAACTTAGGGGG - Intergenic
978239005 4:106493134-106493156 GAACTCCAGAGAAATCCAGCAGG + Intergenic
978551567 4:109933146-109933168 GATGTCCAGAGAAGCGAAGCTGG + Intronic
979779874 4:124637165-124637187 GATTTGGAGAGACAATCAGCAGG - Intergenic
980207215 4:129735315-129735337 GAATTACAGAGAAGCTGAGCTGG + Intergenic
982412927 4:155099424-155099446 CTTTTCCAGAGGAACTCACCAGG - Intergenic
982445208 4:155482945-155482967 GATGTTAAAAGAAACTCAGCTGG - Intergenic
982449728 4:155539528-155539550 GATTTCTAGAGAAGCTAAGGAGG + Intergenic
983383891 4:167033012-167033034 GCTTAGCAGAGATACTCAGCAGG + Intronic
983770513 4:171543268-171543290 GAATTCAAGAGAAAATTAGCAGG - Intergenic
983821137 4:172194440-172194462 GAAGTCCAGAGAAGCTCAGTAGG + Intronic
984763094 4:183378971-183378993 GCTTCCCAGAGACACTCATCCGG - Intergenic
985438083 4:189952497-189952519 GATTTCCAAAGATACTCTTCTGG - Intronic
988041368 5:25892510-25892532 CCTTTCCTGAGAAACTCACCTGG + Intergenic
988270017 5:29002202-29002224 CATTTCCAGAAAAACTTACCTGG + Intergenic
989472420 5:41835966-41835988 CATTTCCAGAGAAACTTAGATGG + Intronic
989810489 5:45666902-45666924 GATATCCAGAAAAAATCAGGGGG + Intronic
994389140 5:99169299-99169321 AATTTCAATAGAATCTCAGCTGG + Intergenic
994848860 5:105026728-105026750 GATTTCTACAGAAACTCTTCTGG + Intergenic
999165870 5:149549143-149549165 GATTTACTGACAAACTCAACAGG + Intronic
1000313246 5:160064666-160064688 GATTCCCAGAGAGAGCCAGCAGG + Intronic
1000529012 5:162394946-162394968 GATTTCAACAGAAACCTAGCAGG + Intergenic
1000689885 5:164304144-164304166 GATTTCCAAAGAAATTCAAGTGG - Intergenic
1002604733 5:180375831-180375853 GTTGTCCAGAGAGACTCAGGGGG + Intergenic
1003023480 6:2531829-2531851 GATTTTCAGAGGACCTGAGCTGG + Intergenic
1003656938 6:8020533-8020555 GATTTCCAGAGAAACTCAGCTGG - Intronic
1003896565 6:10613838-10613860 GATGTCCAGGGATACCCAGCTGG + Intronic
1004386867 6:15180791-15180813 GCCTTACAGAGAAAGTCAGCTGG - Intergenic
1004660846 6:17707804-17707826 GATGTCCAGAGAAATTTAGGTGG + Intergenic
1006831725 6:36972139-36972161 GCTCTCCAGAGTCACTCAGCTGG - Intronic
1010438703 6:75866525-75866547 GATTCCCAGAAAATCTAAGCTGG + Exonic
1012519758 6:100106877-100106899 GTTTTCAAGAGAACTTCAGCAGG - Intergenic
1012688987 6:102290802-102290824 GAATTCCAGAGAAAGACAGAAGG + Intergenic
1014637697 6:123868533-123868555 GTATTACTGAGAAACTCAGCTGG - Intronic
1015038658 6:128689628-128689650 GATTTCAGGAGAAAATCAGAGGG + Intergenic
1015089759 6:129341275-129341297 GACTTCCTGATAATCTCAGCTGG - Intronic
1020887840 7:13841725-13841747 TATTTACAGAGAAGCACAGCAGG - Intergenic
1021297917 7:18932101-18932123 TATTTACAGAAAAACTGAGCAGG - Intronic
1022183594 7:27945289-27945311 GATGTCCAGGGAAGCCCAGCGGG + Intronic
1023373789 7:39536645-39536667 GTTTTCCATAGCAACTCAGCAGG + Intergenic
1026306556 7:69147492-69147514 GGTTTCCGGAGAACCTCACCTGG + Intergenic
1028481963 7:91316811-91316833 AATTTCCTCAGAAACTCAGGTGG - Intergenic
1028716416 7:93976192-93976214 GAGTTACAGAAAAACTGAGCAGG + Intronic
1028864274 7:95689736-95689758 GACTGGCAGAGAAATTCAGCAGG + Intergenic
1031645338 7:124219112-124219134 TTTTTCCAGAGTAACTGAGCTGG + Intergenic
1031933999 7:127717092-127717114 GATTTACAGAAAAATTAAGCAGG + Intronic
1036029663 8:4955020-4955042 GATGTCCCGAGAAAATCAGCTGG - Intronic
1037643577 8:20770693-20770715 GATTTCCATTGAAACCGAGCTGG + Intergenic
1038777309 8:30542770-30542792 GATTTCCAGAGTAACTCACGTGG - Intronic
1041761603 8:61373305-61373327 CTTTTCCAGAGAAACTGGGCAGG - Intronic
1042704665 8:71653530-71653552 GACTTCTAGAGAAACTGTGCTGG - Intergenic
1043378544 8:79677910-79677932 GATCTATAGAGAAACCCAGCTGG + Intergenic
1043515711 8:80993028-80993050 GCTTTCCACAGAAACTCTTCTGG + Intronic
1043860008 8:85305072-85305094 GAATAGCAGAGAATCTCAGCTGG - Intergenic
1048546667 8:135393892-135393914 GATTTCAAGAGAAGCTCACCTGG - Intergenic
1048903124 8:139059164-139059186 AATTCTCAGAGAAACACAGCAGG - Intergenic
1050526227 9:6549247-6549269 GACTGCCAGAGAAACAAAGCAGG + Intronic
1051858112 9:21592934-21592956 GATTTCCACAGAATCTCAAAAGG - Intergenic
1053421642 9:37983585-37983607 GATTCCCAGACAAGCCCAGCTGG - Intronic
1053726678 9:41009215-41009237 GATTTCCAAAGATACTCTTCTGG - Intergenic
1054339263 9:63842593-63842615 GATTTCCAAAGATACTCTTCTGG + Intergenic
1055316613 9:75040174-75040196 GATTTCAAAAGAAACACATCAGG - Intergenic
1056014548 9:82369783-82369805 GATATACAGAGAAAACCAGCTGG - Intergenic
1056891701 9:90500351-90500373 GAATTCCAGAGAATCTCTGTGGG - Intergenic
1057202425 9:93149082-93149104 GAATTCAAGAGAGACTCAACAGG - Intergenic
1057954156 9:99394242-99394264 ACTATCCAGAGAAACCCAGCGGG - Intergenic
1060477666 9:123998315-123998337 GATATCCAGGGAAACTGACCTGG - Intergenic
1060801451 9:126548078-126548100 TATTTCTAGACAGACTCAGCTGG - Intergenic
1060802894 9:126556017-126556039 GATTTCCAGAGAGAGTCTACAGG - Intergenic
1060997764 9:127884799-127884821 GATTTCCTGCCAAACCCAGCAGG - Intergenic
1062341247 9:136094840-136094862 GAAATCCAGGGAAACCCAGCAGG + Intronic
1203448633 Un_GL000219v1:88065-88087 GATTTCCAAAGATACTCTTCTGG + Intergenic
1185826083 X:3251229-3251251 GATAACCAGAGAAAATCTGCTGG + Intergenic
1188310911 X:28615578-28615600 GCTTCACAGGGAAACTCAGCAGG - Intronic
1197257778 X:124282626-124282648 GAATTTCAGAGAAACTTAGCTGG - Intronic
1198084514 X:133269450-133269472 GAGTTCCACAAACACTCAGCCGG + Intergenic
1198389387 X:136159106-136159128 GGTTTACAGAAAAACTAAGCAGG - Intronic
1199607843 X:149590862-149590884 GTTTTCCTGTGAATCTCAGCTGG - Intergenic
1199631280 X:149778506-149778528 GTTTTCCTGTGAATCTCAGCTGG + Intergenic