ID: 1003661127

View in Genome Browser
Species Human (GRCh38)
Location 6:8063843-8063865
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003661124_1003661127 4 Left 1003661124 6:8063816-8063838 CCTTCGTAAGTGTATCTCACTTA 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1003661127 6:8063843-8063865 TCGCACGACCAGGAACAGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr