ID: 1003663178

View in Genome Browser
Species Human (GRCh38)
Location 6:8084022-8084044
Sequence GCCTGCACTTGGACTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003663175_1003663178 10 Left 1003663175 6:8083989-8084011 CCTTGAGAAGGTGTTTATTTCTC 0: 1
1: 0
2: 2
3: 23
4: 292
Right 1003663178 6:8084022-8084044 GCCTGCACTTGGACTAGAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 101
1003663174_1003663178 16 Left 1003663174 6:8083983-8084005 CCTGTTCCTTGAGAAGGTGTTTA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1003663178 6:8084022-8084044 GCCTGCACTTGGACTAGAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003663178 Original CRISPR GCCTGCACTTGGACTAGAGT GGG Intronic