ID: 1003663178

View in Genome Browser
Species Human (GRCh38)
Location 6:8084022-8084044
Sequence GCCTGCACTTGGACTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003663174_1003663178 16 Left 1003663174 6:8083983-8084005 CCTGTTCCTTGAGAAGGTGTTTA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1003663178 6:8084022-8084044 GCCTGCACTTGGACTAGAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 101
1003663175_1003663178 10 Left 1003663175 6:8083989-8084011 CCTTGAGAAGGTGTTTATTTCTC 0: 1
1: 0
2: 2
3: 23
4: 292
Right 1003663178 6:8084022-8084044 GCCTGCACTTGGACTAGAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003663178 Original CRISPR GCCTGCACTTGGACTAGAGT GGG Intronic
902113860 1:14105317-14105339 GCTTCCACTTGGCCAAGAGTTGG + Intergenic
902256741 1:15194066-15194088 GCTTGTTCTTGGACTAGAGAGGG + Intronic
903849588 1:26297875-26297897 GCCAGGAGTTGGACTAGGGTGGG - Intronic
907737832 1:57132435-57132457 GGCTGCACATGGCATAGAGTAGG + Intronic
908281677 1:62544956-62544978 TTCTGCACTTGGACTGGGGTTGG + Exonic
908842603 1:68294567-68294589 GCCTGCACTTGGGTGAGAATTGG - Intergenic
913583293 1:120248742-120248764 GTCTGCACTTGGTCTATACTGGG + Intergenic
913624879 1:120649580-120649602 GTCTGCACTTGGTCTATACTGGG - Intergenic
914565281 1:148860578-148860600 GTCTGCACTTGGTCTATACTGGG + Intronic
914607544 1:149269670-149269692 GTCTGCACTTGGTCTATACTGGG - Intergenic
915334988 1:155135897-155135919 GCCTCCATTACGACTAGAGTCGG - Exonic
920000100 1:202791557-202791579 TGCTTCACTTGGATTAGAGTAGG - Intronic
923506775 1:234611128-234611150 GCCCGAACTTGGACTCGAGGTGG + Intergenic
1063090115 10:2857651-2857673 GTCTGGACTTGGAGTAGAGATGG - Intergenic
1075553045 10:123408004-123408026 CCCTGCACTTCGAGTAGAGGGGG - Intergenic
1080062494 11:27971738-27971760 CCCAGCTCTTGGACTAGAGTGGG + Intergenic
1080251669 11:30240473-30240495 GCCTGGAATTGGACTAAAGAAGG + Intergenic
1081175043 11:39917409-39917431 GCCTACACTTGGCCTACATTTGG - Intergenic
1083868550 11:65472100-65472122 GCAGGCACTTGGTCTAGAGGTGG - Intergenic
1084609322 11:70192091-70192113 CGCTGCACTTGGCCTACAGTAGG - Intergenic
1086120328 11:83299065-83299087 CCCTGAACTTGGACAGGAGTTGG + Intergenic
1086984537 11:93233682-93233704 TCCTGCACTGGGGCTAGAGCAGG - Intergenic
1089526480 11:119100625-119100647 GCCTGCATCTGGACTTGGGTAGG - Exonic
1089640389 11:119843957-119843979 GCCTGGGCGTGGACTAGAATTGG + Intergenic
1096398437 12:51285289-51285311 CCCTGCACGTGGTCTAGACTGGG - Intronic
1096459757 12:51815575-51815597 GTCTGGACTTGCACTGGAGTGGG - Intergenic
1106807271 13:33323219-33323241 GCAAGCACTTGGACTAGAGCAGG - Intronic
1107346406 13:39466058-39466080 GCCAGCCTTTGGAGTAGAGTGGG + Intronic
1107434820 13:40372946-40372968 CCCTGCACTTGGTATAGAGAAGG - Intergenic
1110508881 13:76325079-76325101 GCCTGGACTAGGACTAAAGAAGG - Intergenic
1112626847 13:101114635-101114657 GCATGCATTTGGACTTGAATGGG - Intronic
1113319351 13:109217706-109217728 GCCTGCAGATGGACTATTGTGGG + Intergenic
1114822787 14:26041709-26041731 GCCTCCACTTGCACAAGGGTAGG - Intergenic
1118150064 14:63179570-63179592 GCCTGCACTTGGCCTATTGTGGG + Intergenic
1125585093 15:40814192-40814214 GCCTGCACGTGGAGGAGAGTAGG - Exonic
1126439646 15:48673685-48673707 GGCAGAACTTGGACTAGAGTTGG - Intergenic
1129584495 15:76849018-76849040 TCCTGCCCTTGGACTAGGGGAGG + Intronic
1133568539 16:7018828-7018850 CACTGCACCTGGCCTAGAGTGGG - Intronic
1134376719 16:13682698-13682720 GCCAGCACTGGCACTTGAGTGGG + Intergenic
1135227098 16:20670407-20670429 GCTTGCACCTGGATTAGACTAGG + Intronic
1136499568 16:30663646-30663668 GCCAGCACTTGGCCTACAGCAGG + Intronic
1145755049 17:27384336-27384358 GCCTGCACTGAGACCAGAGCCGG - Intergenic
1150479667 17:65499508-65499530 GGTGGCACTTGGACTAGAATTGG + Intergenic
1163849776 19:19656385-19656407 GCCTGCACTTGGCCTCGTCTGGG + Intronic
1164205116 19:23052052-23052074 GCCTGCACCTGGCCTACAGGGGG - Intergenic
1168150513 19:54445064-54445086 GCTTGCAGATGGACTATAGTGGG + Intergenic
926435629 2:12834805-12834827 TCCTCCAGTTGAACTAGAGTAGG - Intergenic
927239139 2:20904646-20904668 GCCTGCAGTTGGCCTATTGTGGG + Intergenic
931830935 2:66050743-66050765 GGCTGCACGTGGCCAAGAGTGGG + Intergenic
932622528 2:73273460-73273482 GCCTGCACTTTGAATAGATTTGG + Intronic
937773275 2:125746722-125746744 CCCTGCACTTGGTACAGAGTGGG + Intergenic
939183910 2:138838126-138838148 GCCTGAACTTGGCCTTGAGAAGG - Intergenic
944483318 2:200178919-200178941 GCCTGCACTTGGCATAGGATAGG + Intergenic
948704303 2:239779537-239779559 GTCTGCACTTGGCCTAAAGACGG - Intronic
948896455 2:240930085-240930107 ACATGCACTTGGAAAAGAGTGGG + Intronic
1170743660 20:19079573-19079595 AGCTGCACTTGGAGTGGAGTGGG - Intergenic
1176960884 21:15157652-15157674 GCCTGCATTTGGTCAAAAGTAGG + Intergenic
1178426877 21:32485691-32485713 GTCTCCACTTAGACAAGAGTGGG - Intronic
1184091150 22:42293643-42293665 GCCTGCCCTTAGGCTAGGGTTGG - Intronic
950497071 3:13340192-13340214 GCCTGCACTGGGGCTGGAGCAGG + Intronic
951580879 3:24161058-24161080 GTCTGCACTTGGACTTGGTTTGG + Intronic
952248408 3:31623816-31623838 GACTACACTTGGACTAGAGTAGG - Exonic
952991255 3:38832915-38832937 GCCTGGGCTTGGTCTGGAGTGGG + Intergenic
955708712 3:61755873-61755895 ACCTGGAATTGGACTACAGTTGG + Intronic
955907091 3:63818414-63818436 GACTGCACTTGGAGTAGTGAGGG - Intergenic
958745575 3:98129546-98129568 GCCTGCACTTGGATTATGGATGG - Intergenic
960226171 3:115171895-115171917 GGCTTCATTTGGAGTAGAGTCGG - Intergenic
962648587 3:137465061-137465083 GCCTGGACTTGGAGTAGAGCCGG + Intergenic
968742492 4:2338297-2338319 TACTGCACCTGGCCTAGAGTTGG - Intronic
969058243 4:4415364-4415386 GCCTGCACTTGGAGGAGCTTGGG - Intronic
970497102 4:16637484-16637506 CCCTGCACTTGGCTCAGAGTGGG - Intronic
970884781 4:20975736-20975758 GCCAGCCCTTGTTCTAGAGTTGG - Intronic
975717776 4:77221671-77221693 GCCTACACTTGTGCCAGAGTTGG - Intronic
977448623 4:97164753-97164775 GCCTGCAGATGGCCTAGTGTGGG - Intergenic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
983454458 4:167945419-167945441 TCCTGCCCTTGGACAAGTGTGGG - Intergenic
989255051 5:39357654-39357676 GACTGCCCTAGGACTGGAGTTGG + Intronic
994121508 5:96119051-96119073 GCTTGCAGTTGGACTATAATGGG + Intergenic
996909446 5:128638425-128638447 GCCTGCACATGGACAAGCATGGG + Intronic
1003528827 6:6920713-6920735 GCCTGCATGTGGACTTGAGGAGG - Intergenic
1003663178 6:8084022-8084044 GCCTGCACTTGGACTAGAGTGGG + Intronic
1006441494 6:34056393-34056415 GCCTGCACCTGGGGTGGAGTTGG - Intronic
1010514204 6:76753422-76753444 GCCTCCCCTTGGACTAGAGCAGG - Intergenic
1011345543 6:86366047-86366069 GCCTGCCCTGGGACAAGAGAGGG - Intergenic
1013451594 6:110286942-110286964 GCCTGCAGATGGCCTATAGTGGG + Intronic
1018666625 6:166144320-166144342 GCCTGAACTTGCACTTGAGTAGG - Intergenic
1020434370 7:8146944-8146966 GGCTTCACTTTGACCAGAGTTGG - Intronic
1026101851 7:67390326-67390348 ACCAGCACTAGGACTAGAGTGGG - Intergenic
1027879986 7:83822355-83822377 GCTTGCAGATGGTCTAGAGTGGG + Intergenic
1028133357 7:87202897-87202919 GACTGCACTTGGGCCAGAGAAGG + Intronic
1030799181 7:113828228-113828250 GGATGCAGTGGGACTAGAGTAGG - Intergenic
1031243133 7:119271068-119271090 GCTTGCAGGTGGACTAGAGAGGG + Intergenic
1032184639 7:129713816-129713838 CCCTGAGCTTAGACTAGAGTGGG + Intronic
1032764003 7:134973904-134973926 GCCTGCAGATGGACTATTGTGGG - Intergenic
1033600050 7:142882885-142882907 GCCAGCACATGGGCTGGAGTGGG + Intronic
1033865091 7:145680652-145680674 GCCAACACTTGGACATGAGTTGG + Intergenic
1036410668 8:8497400-8497422 GCCTGCAGCTGTAGTAGAGTTGG - Intergenic
1037605636 8:20435220-20435242 GCCTGCGCTGGCACTGGAGTGGG + Intergenic
1040704599 8:50110367-50110389 GCCTGCACCTGTGTTAGAGTAGG - Intronic
1041447702 8:57970814-57970836 GTCTGCACTTAGAATAGAGCTGG - Intergenic
1043213174 8:77550993-77551015 GCCTGCACATGGAGCAGAGAGGG + Intergenic
1047453977 8:124992133-124992155 GCCTGCACGTGGCCTATGGTGGG + Intergenic
1048831290 8:138479747-138479769 CACTGGACTTGGACTATAGTAGG + Intronic
1049010739 8:139885560-139885582 ACTTGCACTTGGTGTAGAGTGGG - Intronic
1050568919 9:6917321-6917343 GCATGCACTTGGACCCCAGTAGG + Intronic
1057246864 9:93463537-93463559 TTCTTCAGTTGGACTAGAGTAGG + Intronic
1060396194 9:123318694-123318716 GCCTCCCCTTGGGCTGGAGTTGG + Intergenic
1061999851 9:134210419-134210441 CCCTGGGCTTGGACTAGACTTGG - Intergenic
1062539467 9:137035211-137035233 GTCTGCTCTTGGTCTGGAGTGGG - Exonic
1186670852 X:11765712-11765734 TCCTGCACCTGGAAAAGAGTAGG + Exonic
1188106366 X:26152214-26152236 GCCTCCACTTGGACAAAAGAGGG + Intergenic
1197002616 X:121455606-121455628 GCCTGCACATGGCCTATTGTGGG + Intergenic
1198218056 X:134574754-134574776 GCCTGGACTTGGTCTAGATACGG - Intronic