ID: 1003665800

View in Genome Browser
Species Human (GRCh38)
Location 6:8110145-8110167
Sequence TTGCTGTTGTTGTTGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6733
Summary {0: 8, 1: 211, 2: 430, 3: 1079, 4: 5005}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003665800_1003665803 18 Left 1003665800 6:8110145-8110167 CCCTGTCTCAACAACAACAGCAA 0: 8
1: 211
2: 430
3: 1079
4: 5005
Right 1003665803 6:8110186-8110208 AAAAAAGAAAGAAAGAAGATGGG No data
1003665800_1003665804 29 Left 1003665800 6:8110145-8110167 CCCTGTCTCAACAACAACAGCAA 0: 8
1: 211
2: 430
3: 1079
4: 5005
Right 1003665804 6:8110197-8110219 AAAGAAGATGGGTTTTAGAATGG No data
1003665800_1003665802 17 Left 1003665800 6:8110145-8110167 CCCTGTCTCAACAACAACAGCAA 0: 8
1: 211
2: 430
3: 1079
4: 5005
Right 1003665802 6:8110185-8110207 AAAAAAAGAAAGAAAGAAGATGG 0: 8
1: 310
2: 1997
3: 10653
4: 56247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003665800 Original CRISPR TTGCTGTTGTTGTTGAGACA GGG (reversed) Intergenic
Too many off-targets to display for this crispr