ID: 1003667101

View in Genome Browser
Species Human (GRCh38)
Location 6:8121578-8121600
Sequence ACTCACTCACCTCCAAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003667101_1003667106 21 Left 1003667101 6:8121578-8121600 CCCTTCCTTGGAGGTGAGTGAGT No data
Right 1003667106 6:8121622-8121644 GAGAGCTGGTTGTTAAAAAAAGG No data
1003667101_1003667104 -8 Left 1003667101 6:8121578-8121600 CCCTTCCTTGGAGGTGAGTGAGT No data
Right 1003667104 6:8121593-8121615 GAGTGAGTTCTCACTCTGTCAGG No data
1003667101_1003667105 7 Left 1003667101 6:8121578-8121600 CCCTTCCTTGGAGGTGAGTGAGT No data
Right 1003667105 6:8121608-8121630 CTGTCAGGTACTGAGAGAGCTGG No data
1003667101_1003667107 25 Left 1003667101 6:8121578-8121600 CCCTTCCTTGGAGGTGAGTGAGT No data
Right 1003667107 6:8121626-8121648 GCTGGTTGTTAAAAAAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003667101 Original CRISPR ACTCACTCACCTCCAAGGAA GGG (reversed) Intergenic
No off target data available for this crispr