ID: 1003672300

View in Genome Browser
Species Human (GRCh38)
Location 6:8170748-8170770
Sequence CAGGTTTTATATGGTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003672290_1003672300 17 Left 1003672290 6:8170708-8170730 CCAAGCCAAATGGAAGGGAGAAG No data
Right 1003672300 6:8170748-8170770 CAGGTTTTATATGGTTTTAAAGG No data
1003672291_1003672300 12 Left 1003672291 6:8170713-8170735 CCAAATGGAAGGGAGAAGTACTG No data
Right 1003672300 6:8170748-8170770 CAGGTTTTATATGGTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003672300 Original CRISPR CAGGTTTTATATGGTTTTAA AGG Intergenic
No off target data available for this crispr