ID: 1003673677

View in Genome Browser
Species Human (GRCh38)
Location 6:8182797-8182819
Sequence CTGAAAATACAAATAGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003673677_1003673681 29 Left 1003673677 6:8182797-8182819 CCTCTGTCTATTTGTATTTTCAG No data
Right 1003673681 6:8182849-8182871 AGAGATCATCTCTGGATTTCAGG No data
1003673677_1003673680 21 Left 1003673677 6:8182797-8182819 CCTCTGTCTATTTGTATTTTCAG No data
Right 1003673680 6:8182841-8182863 GTGAAATAAGAGATCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003673677 Original CRISPR CTGAAAATACAAATAGACAG AGG (reversed) Intergenic
No off target data available for this crispr