ID: 1003681337

View in Genome Browser
Species Human (GRCh38)
Location 6:8260380-8260402
Sequence CTAATCACTGGGAAATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003681329_1003681337 17 Left 1003681329 6:8260340-8260362 CCATTTTTAGATTCCCTTTCTTT No data
Right 1003681337 6:8260380-8260402 CTAATCACTGGGAAATGGGGTGG No data
1003681330_1003681337 4 Left 1003681330 6:8260353-8260375 CCCTTTCTTTAGCTATAGTCTAA No data
Right 1003681337 6:8260380-8260402 CTAATCACTGGGAAATGGGGTGG No data
1003681331_1003681337 3 Left 1003681331 6:8260354-8260376 CCTTTCTTTAGCTATAGTCTAAT No data
Right 1003681337 6:8260380-8260402 CTAATCACTGGGAAATGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003681337 Original CRISPR CTAATCACTGGGAAATGGGG TGG Intergenic
No off target data available for this crispr