ID: 1003682658

View in Genome Browser
Species Human (GRCh38)
Location 6:8271402-8271424
Sequence CCTTGTATGGGAACAATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003682652_1003682658 27 Left 1003682652 6:8271352-8271374 CCTCTGAGGAAAAGGATTATTTT No data
Right 1003682658 6:8271402-8271424 CCTTGTATGGGAACAATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003682658 Original CRISPR CCTTGTATGGGAACAATGGC TGG Intergenic
No off target data available for this crispr