ID: 1003684695

View in Genome Browser
Species Human (GRCh38)
Location 6:8290378-8290400
Sequence ACTGTATCTTGGGGGAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003684695_1003684703 -5 Left 1003684695 6:8290378-8290400 CCCCTTTTCCCCCAAGATACAGT No data
Right 1003684703 6:8290396-8290418 ACAGTTGTTGCCTATTTTGGAGG No data
1003684695_1003684702 -8 Left 1003684695 6:8290378-8290400 CCCCTTTTCCCCCAAGATACAGT No data
Right 1003684702 6:8290393-8290415 GATACAGTTGTTGCCTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003684695 Original CRISPR ACTGTATCTTGGGGGAAAAG GGG (reversed) Intergenic
No off target data available for this crispr