ID: 1003689725

View in Genome Browser
Species Human (GRCh38)
Location 6:8341340-8341362
Sequence CACTACCCAGTAGTGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003689725_1003689729 -7 Left 1003689725 6:8341340-8341362 CCAAGAGCCACTACTGGGTAGTG No data
Right 1003689729 6:8341356-8341378 GGTAGTGGTAACTTACTCATGGG No data
1003689725_1003689730 -6 Left 1003689725 6:8341340-8341362 CCAAGAGCCACTACTGGGTAGTG No data
Right 1003689730 6:8341357-8341379 GTAGTGGTAACTTACTCATGGGG No data
1003689725_1003689728 -8 Left 1003689725 6:8341340-8341362 CCAAGAGCCACTACTGGGTAGTG No data
Right 1003689728 6:8341355-8341377 GGGTAGTGGTAACTTACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003689725 Original CRISPR CACTACCCAGTAGTGGCTCT TGG (reversed) Intergenic
No off target data available for this crispr