ID: 1003689728

View in Genome Browser
Species Human (GRCh38)
Location 6:8341355-8341377
Sequence GGGTAGTGGTAACTTACTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003689725_1003689728 -8 Left 1003689725 6:8341340-8341362 CCAAGAGCCACTACTGGGTAGTG No data
Right 1003689728 6:8341355-8341377 GGGTAGTGGTAACTTACTCATGG No data
1003689717_1003689728 9 Left 1003689717 6:8341323-8341345 CCTTCCTTCCACCCATCCCAAGA No data
Right 1003689728 6:8341355-8341377 GGGTAGTGGTAACTTACTCATGG No data
1003689718_1003689728 5 Left 1003689718 6:8341327-8341349 CCTTCCACCCATCCCAAGAGCCA No data
Right 1003689728 6:8341355-8341377 GGGTAGTGGTAACTTACTCATGG No data
1003689720_1003689728 -2 Left 1003689720 6:8341334-8341356 CCCATCCCAAGAGCCACTACTGG No data
Right 1003689728 6:8341355-8341377 GGGTAGTGGTAACTTACTCATGG No data
1003689716_1003689728 18 Left 1003689716 6:8341314-8341336 CCTCGTCATCCTTCCTTCCACCC No data
Right 1003689728 6:8341355-8341377 GGGTAGTGGTAACTTACTCATGG No data
1003689715_1003689728 25 Left 1003689715 6:8341307-8341329 CCATATACCTCGTCATCCTTCCT No data
Right 1003689728 6:8341355-8341377 GGGTAGTGGTAACTTACTCATGG No data
1003689719_1003689728 1 Left 1003689719 6:8341331-8341353 CCACCCATCCCAAGAGCCACTAC No data
Right 1003689728 6:8341355-8341377 GGGTAGTGGTAACTTACTCATGG No data
1003689722_1003689728 -3 Left 1003689722 6:8341335-8341357 CCATCCCAAGAGCCACTACTGGG No data
Right 1003689728 6:8341355-8341377 GGGTAGTGGTAACTTACTCATGG No data
1003689724_1003689728 -7 Left 1003689724 6:8341339-8341361 CCCAAGAGCCACTACTGGGTAGT No data
Right 1003689728 6:8341355-8341377 GGGTAGTGGTAACTTACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003689728 Original CRISPR GGGTAGTGGTAACTTACTCA TGG Intergenic
No off target data available for this crispr