ID: 1003691810

View in Genome Browser
Species Human (GRCh38)
Location 6:8362271-8362293
Sequence GTCTGTAAGTGGAAGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003691810_1003691812 4 Left 1003691810 6:8362271-8362293 CCATCACACTTCCACTTACAGAC No data
Right 1003691812 6:8362298-8362320 AGAATTCACTGTGTTCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003691810 Original CRISPR GTCTGTAAGTGGAAGTGTGA TGG (reversed) Intergenic
No off target data available for this crispr