ID: 1003695894

View in Genome Browser
Species Human (GRCh38)
Location 6:8406120-8406142
Sequence GGCCTGTTACAGGGCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003695894_1003695902 26 Left 1003695894 6:8406120-8406142 CCACCAAAGCCCTGTAACAGGCC No data
Right 1003695902 6:8406169-8406191 GTCATCTGCAGAAGATGGCAGGG No data
1003695894_1003695900 21 Left 1003695894 6:8406120-8406142 CCACCAAAGCCCTGTAACAGGCC No data
Right 1003695900 6:8406164-8406186 GAGTAGTCATCTGCAGAAGATGG No data
1003695894_1003695898 -3 Left 1003695894 6:8406120-8406142 CCACCAAAGCCCTGTAACAGGCC No data
Right 1003695898 6:8406140-8406162 GCCAAGAGCTGTCTCTCAAAAGG 0: 173
1: 182
2: 165
3: 95
4: 236
1003695894_1003695901 25 Left 1003695894 6:8406120-8406142 CCACCAAAGCCCTGTAACAGGCC No data
Right 1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003695894 Original CRISPR GGCCTGTTACAGGGCTTTGG TGG (reversed) Intergenic
No off target data available for this crispr