ID: 1003695896

View in Genome Browser
Species Human (GRCh38)
Location 6:8406129-8406151
Sequence ACAGCTCTTGGCCTGTTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003695896_1003695901 16 Left 1003695896 6:8406129-8406151 CCCTGTAACAGGCCAAGAGCTGT No data
Right 1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG No data
1003695896_1003695900 12 Left 1003695896 6:8406129-8406151 CCCTGTAACAGGCCAAGAGCTGT No data
Right 1003695900 6:8406164-8406186 GAGTAGTCATCTGCAGAAGATGG No data
1003695896_1003695902 17 Left 1003695896 6:8406129-8406151 CCCTGTAACAGGCCAAGAGCTGT No data
Right 1003695902 6:8406169-8406191 GTCATCTGCAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003695896 Original CRISPR ACAGCTCTTGGCCTGTTACA GGG (reversed) Intergenic
No off target data available for this crispr