ID: 1003695901

View in Genome Browser
Species Human (GRCh38)
Location 6:8406168-8406190
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003695895_1003695901 22 Left 1003695895 6:8406123-8406145 CCAAAGCCCTGTAACAGGCCAAG No data
Right 1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG No data
1003695897_1003695901 15 Left 1003695897 6:8406130-8406152 CCTGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG No data
1003695896_1003695901 16 Left 1003695896 6:8406129-8406151 CCCTGTAACAGGCCAAGAGCTGT No data
Right 1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG No data
1003695899_1003695901 4 Left 1003695899 6:8406141-8406163 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG No data
1003695894_1003695901 25 Left 1003695894 6:8406120-8406142 CCACCAAAGCCCTGTAACAGGCC No data
Right 1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003695901 Original CRISPR AGTCATCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr