ID: 1003697386

View in Genome Browser
Species Human (GRCh38)
Location 6:8423839-8423861
Sequence GCATTTACACTGATGCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 120}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003697386_1003697388 -6 Left 1003697386 6:8423839-8423861 CCCATATGCATCAGTGTAAATGC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1003697388 6:8423856-8423878 AAATGCGTTCATGCCATCCATGG No data
1003697386_1003697393 11 Left 1003697386 6:8423839-8423861 CCCATATGCATCAGTGTAAATGC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1003697393 6:8423873-8423895 CCATGGGGTTTGACCCTCATTGG 0: 1
1: 0
2: 0
3: 1
4: 72
1003697386_1003697389 -5 Left 1003697386 6:8423839-8423861 CCCATATGCATCAGTGTAAATGC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1003697389 6:8423857-8423879 AATGCGTTCATGCCATCCATGGG 0: 1
1: 0
2: 0
3: 3
4: 70
1003697386_1003697397 28 Left 1003697386 6:8423839-8423861 CCCATATGCATCAGTGTAAATGC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1003697397 6:8423890-8423912 CATTGGGATATCATCAGTGATGG 0: 1
1: 0
2: 0
3: 15
4: 187
1003697386_1003697390 -4 Left 1003697386 6:8423839-8423861 CCCATATGCATCAGTGTAAATGC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1003697390 6:8423858-8423880 ATGCGTTCATGCCATCCATGGGG 0: 1
1: 0
2: 0
3: 6
4: 82
1003697386_1003697394 12 Left 1003697386 6:8423839-8423861 CCCATATGCATCAGTGTAAATGC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1003697394 6:8423874-8423896 CATGGGGTTTGACCCTCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003697386 Original CRISPR GCATTTACACTGATGCATAT GGG (reversed) Intronic
901582124 1:10253129-10253151 GCCTTGACAATGCTGCATATAGG + Intronic
907760453 1:57353468-57353490 GCATTTACTCTGTTGTCTATTGG - Intronic
909058484 1:70850942-70850964 GCATTGACACTTATGCAAAAAGG - Intergenic
911263948 1:95720924-95720946 GCATCTACTCTGATGCAGACAGG - Intergenic
912101273 1:106209240-106209262 GAATTTGCACTGATGATTATGGG - Intergenic
915520781 1:156441600-156441622 GGCTTGACAATGATGCATATCGG + Intergenic
916336952 1:163683501-163683523 GCATTTTCACATATGCTTATTGG - Intergenic
916976656 1:170087786-170087808 GCATTTAAATTGTTGCATGTAGG + Intergenic
920699111 1:208204358-208204380 GCATTTACACTGTTGCCTGGAGG - Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
922828312 1:228537013-228537035 GCATTTCCTTTGAAGCATATGGG - Intergenic
923990429 1:239430415-239430437 TATTTTACACAGATGCATATCGG - Intronic
1063246809 10:4228929-4228951 GCATTTTCAAAGATGCATATAGG + Intergenic
1064424340 10:15216913-15216935 ACATTTAAACTGATTCATTTGGG - Intronic
1066987790 10:42483542-42483564 GCAATTACACTGATGCAGACAGG + Intergenic
1071284682 10:84133586-84133608 GAATTTTCTCTGATGCATTTTGG + Intergenic
1071399575 10:85256334-85256356 GCATGTACCCTGATACATTTGGG - Intergenic
1071446545 10:85753958-85753980 GCATTAGCACTGGTGCTTATAGG - Intronic
1071921210 10:90352559-90352581 GCATTTACTCTGAAGGAGATCGG - Intergenic
1075559939 10:123460880-123460902 GGATTTACCCTGCTGCATAAGGG - Intergenic
1077992032 11:7420658-7420680 GCATTTACTCTTATGCAAAGTGG - Intronic
1080019628 11:27546510-27546532 GCCTATACACAGATACATATGGG + Intergenic
1081138804 11:39472647-39472669 TCATCTTCACTGATGCATCTTGG - Intergenic
1081473798 11:43404122-43404144 GCAGGGACTCTGATGCATATAGG + Exonic
1083049498 11:59764548-59764570 TCTTTTTCACTCATGCATATAGG + Intronic
1087818267 11:102682730-102682752 GCAATTCCATTTATGCATATGGG - Intronic
1089108594 11:116036176-116036198 TCATTTACAGTGATGGATTTGGG - Intergenic
1089342576 11:117768590-117768612 GCAATTTCTCTGATGCATTTAGG + Intronic
1092520512 12:9267702-9267724 GCATTTCAACTGATTTATATAGG - Intergenic
1093385807 12:18551860-18551882 GAATTTACACTGAGGAATATTGG - Intronic
1097490776 12:60268058-60268080 GCATATACACTCATGCATAAAGG - Intergenic
1099697214 12:86038169-86038191 GCATTTCCTTTGAAGCATATGGG + Intronic
1100683221 12:96953372-96953394 ACATTTGTACTGAAGCATATAGG + Intronic
1101619659 12:106372639-106372661 GCATTTAAAGTTATGGATATTGG - Intronic
1104484651 12:129140110-129140132 GCATATACTTTGATGCATTTGGG + Intronic
1104809775 12:131613110-131613132 GCATTTCCACAGATGCGTCTGGG + Intergenic
1105054595 12:133086166-133086188 GCATGTATCCTGATACATATTGG + Intronic
1106459076 13:29952675-29952697 GCTTTGACAATGATGGATATAGG + Intergenic
1107091096 13:36480959-36480981 GCATTAACACTGATAAATAAGGG - Intergenic
1107713673 13:43176530-43176552 GCATTTACTCTTATGTATTTTGG + Intergenic
1108330893 13:49381663-49381685 GCATCTATACTGTTGCATGTAGG + Intronic
1108499102 13:51052799-51052821 CCATTCACACTCCTGCATATAGG - Intergenic
1109785382 13:67167855-67167877 GCATTAAGACTAATGCATACAGG + Intronic
1109835590 13:67852400-67852422 GCATTTCCACTGCTGCACATGGG + Intergenic
1110305405 13:73981447-73981469 TCATTCACATTGATGCGTATAGG - Intronic
1110522484 13:76497064-76497086 GCTTTTAAACTGATGTATAAAGG - Intergenic
1112739094 13:102453925-102453947 GCATTTACACAGATACAAGTAGG - Intergenic
1120487144 14:85128238-85128260 GCATTTACTTTAATCCATATTGG + Intergenic
1133749585 16:8714003-8714025 GCATGTACACAGATGCACAAGGG - Intronic
1135919290 16:26634142-26634164 GCATTTATTCTCATGCTTATGGG + Intergenic
1140952807 16:79835394-79835416 GCATTTAAACTGACACAGATGGG + Intergenic
1140962308 16:79928043-79928065 GCATTTACACTGAGAACTATGGG - Intergenic
1141500495 16:84440990-84441012 GCATTTACATTGAGGCTTCTGGG + Intronic
1146246605 17:31289764-31289786 GCATTTAAACTTTTGCCTATAGG - Intronic
1146802163 17:35833958-35833980 GCATTTCCACTGAAACATTTTGG - Intronic
1151385451 17:73752654-73752676 GCATTTACCCTGACGAATCTGGG + Intergenic
1151774732 17:76191994-76192016 GCATTTAAAGAGATGCATAGTGG - Intronic
1153137496 18:1933357-1933379 ACATTTACTCTGAATCATATAGG + Intergenic
1156810672 18:41246211-41246233 GCAATTCCACTGATGGGTATAGG - Intergenic
1156954612 18:42947142-42947164 GCATTTAGACATATGGATATGGG + Intronic
1158104568 18:53871143-53871165 GCACTTACAGAAATGCATATTGG - Intergenic
1159265863 18:66077706-66077728 GCTTTTACTCTGATGGATTTTGG - Intergenic
1160154221 18:76421206-76421228 GCGTTTAGGCTGGTGCATATTGG + Intronic
1160453845 18:78981986-78982008 GTATTTACATTGTTGCATTTTGG - Intronic
1164493147 19:28732570-28732592 GCATTTATACTGCTGCAAAGGGG + Intergenic
926183413 2:10666775-10666797 GTATGTACACATATGCATATTGG + Intronic
926378450 2:12259669-12259691 GCAATTACACAGAAGCATAGTGG + Intergenic
930313880 2:49773382-49773404 GGATTTAGACTGATTCATCTTGG + Intergenic
931085608 2:58827077-58827099 TCAATATCACTGATGCATATTGG - Intergenic
932267342 2:70379264-70379286 GCATTTATAGATATGCATATTGG + Intergenic
939091853 2:137789332-137789354 ACGTTTAGTCTGATGCATATAGG + Intergenic
941147944 2:161876144-161876166 GTATTTACACTCATGCTTCTGGG - Intronic
941152453 2:161931592-161931614 GCTTTTACTCTGATGCATCCTGG - Intronic
944701304 2:202248732-202248754 GCATTATCACGGGTGCATATGGG - Intergenic
947907827 2:233778394-233778416 GCATTTCCATTGATGTGTATTGG + Intronic
1169726612 20:8740837-8740859 GCATTTACACTTATGATTCTTGG - Intronic
1177649311 21:23940066-23940088 AGACTTAAACTGATGCATATAGG + Intergenic
1178890665 21:36518629-36518651 AAATTTACACTTCTGCATATAGG + Intronic
1178979559 21:37251352-37251374 TCATTTACACTAGTACATATGGG + Intronic
1181704391 22:24640331-24640353 CAGTTTACACTGATGCATTTAGG + Intergenic
949187190 3:1206334-1206356 GAAAATACACTGATGCATGTGGG - Intronic
951763645 3:26172481-26172503 AAATTCACACTGATGCATTTAGG - Intergenic
953125272 3:40086700-40086722 GCATTATCTCTGATGCATAGTGG - Intronic
958504177 3:94952999-94953021 TAATTTACAGTGATGCAAATTGG + Intergenic
958626342 3:96628870-96628892 GCATTTTTACTGTGGCATATTGG - Intergenic
961856706 3:129878694-129878716 GCATTTACACTGAGCAAAATAGG - Intronic
963926337 3:150955327-150955349 GCATTTTGACTAATGCATATTGG - Intronic
972203139 4:36739701-36739723 GCATTGACAGTGATGTATAAAGG + Intergenic
973197887 4:47466447-47466469 GCATTTATACTAAGGCATAAAGG + Intergenic
974384412 4:61186407-61186429 GCATTTACCCTGACAGATATTGG - Intergenic
974835890 4:67250511-67250533 GCATTTACAATGAGGGTTATGGG + Intergenic
977392140 4:96425555-96425577 GCATTTTCAATGATACATGTGGG + Intergenic
978685209 4:111434113-111434135 TCTTTTACCCTGATGCATGTTGG + Intergenic
980310374 4:131121343-131121365 GGATTTAAACTGTTGCATTTTGG - Intergenic
980781343 4:137496045-137496067 GCATTCACACTGATATATGTAGG + Intergenic
981398652 4:144285305-144285327 GCATTGATTTTGATGCATATTGG - Intergenic
982339015 4:154274041-154274063 GCTTTTACCCAAATGCATATGGG - Intronic
988112625 5:26842467-26842489 ACATTTTCACTGATACATAATGG - Intergenic
989343797 5:40407022-40407044 ACATTGTCACTGTTGCATATAGG - Intergenic
994927904 5:106142902-106142924 GCATATAAACTAAAGCATATGGG - Intergenic
996438293 5:123460094-123460116 GCAATTACAGTGATCCAGATAGG - Intergenic
1003697386 6:8423839-8423861 GCATTTACACTGATGCATATGGG - Intronic
1004206226 6:13594054-13594076 GCCTTTCCACTGATGCCTTTTGG - Intronic
1007512487 6:42384748-42384770 ACATTTGAACTGATGCGTATGGG - Intronic
1011486646 6:87849147-87849169 GCATTTACAATCATCCAAATTGG + Intergenic
1014682811 6:124453561-124453583 GAATTTAAAATGCTGCATATTGG - Intronic
1021258827 7:18428745-18428767 GCTTTTACTCTGAGGCAGATGGG - Intronic
1024481788 7:49870819-49870841 TCATTTATACTGATGCTTGTGGG + Intronic
1028093108 7:86727736-86727758 ACATTTACACTCATACATATGGG - Intronic
1028208425 7:88043754-88043776 GCTTTTTCACTGATTCAAATTGG - Intronic
1028485632 7:91354530-91354552 ACATATACACTGATGTATAGGGG - Intergenic
1038934032 8:32228225-32228247 CCATTTACACTGATAAGTATAGG - Intronic
1041343219 8:56867725-56867747 GCATCTAAACTGATAAATATTGG + Intergenic
1042217806 8:66443889-66443911 GCTTTTACACTGATGGATGATGG - Intronic
1045831411 8:106465409-106465431 GCTTTAACACTGATTGATATGGG + Intronic
1046733608 8:117752188-117752210 ACATTTACACAGCTGCATAGTGG + Intergenic
1048041563 8:130733943-130733965 GGATTTACACTGAGACATAAAGG - Intergenic
1048829232 8:138459871-138459893 GGATTTAAACTGATGCATTCTGG - Intronic
1049511552 8:143029387-143029409 GCATTTTCACGGGTGCATGTGGG - Intergenic
1054651264 9:67626026-67626048 GGATTTTCAATTATGCATATAGG - Intergenic
1056109827 9:83383981-83384003 GTATGAACACTGATGCATTTGGG - Intronic
1059641728 9:116223734-116223756 GAATTTATACTCATGCAAATTGG + Intronic
1189053417 X:37671466-37671488 GCTTTTACTCTGAATCATATGGG - Intronic
1190027639 X:46940395-46940417 GCATTGAGACTCATGCATAAGGG + Intronic
1199256037 X:145719829-145719851 GCATATACAGTGTTTCATATAGG - Intergenic
1199588815 X:149446303-149446325 GCATACACACTGATGCCTGTTGG - Intergenic
1199934445 X:152558607-152558629 TCCTTTATAGTGATGCATATGGG - Intergenic
1201749113 Y:17413208-17413230 GCAATTAAATTGATGCAAATTGG - Intergenic