ID: 1003700006

View in Genome Browser
Species Human (GRCh38)
Location 6:8452922-8452944
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003700004_1003700006 -3 Left 1003700004 6:8452902-8452924 CCAAGACTTGGGCACAAGCTGCA No data
Right 1003700006 6:8452922-8452944 GCATCTTCTTATTTTAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003700006 Original CRISPR GCATCTTCTTATTTTAGATT GGG Intergenic
No off target data available for this crispr