ID: 1003700058

View in Genome Browser
Species Human (GRCh38)
Location 6:8453845-8453867
Sequence TTGGCAAAGGGGAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003700058_1003700068 3 Left 1003700058 6:8453845-8453867 CCCTCCCCATTCCCCTTTGCCAA No data
Right 1003700068 6:8453871-8453893 GATTAACAGTTCCCTTTCTTGGG No data
1003700058_1003700067 2 Left 1003700058 6:8453845-8453867 CCCTCCCCATTCCCCTTTGCCAA No data
Right 1003700067 6:8453870-8453892 AGATTAACAGTTCCCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003700058 Original CRISPR TTGGCAAAGGGGAATGGGGA GGG (reversed) Intergenic
No off target data available for this crispr