ID: 1003702512

View in Genome Browser
Species Human (GRCh38)
Location 6:8484294-8484316
Sequence ATTGTATGGACTCTGCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003702512_1003702515 6 Left 1003702512 6:8484294-8484316 CCTGAAGGCAGAGTCCATACAAT No data
Right 1003702515 6:8484323-8484345 TTCATTGTATTATAAAATGAAGG No data
1003702512_1003702516 7 Left 1003702512 6:8484294-8484316 CCTGAAGGCAGAGTCCATACAAT No data
Right 1003702516 6:8484324-8484346 TCATTGTATTATAAAATGAAGGG No data
1003702512_1003702517 30 Left 1003702512 6:8484294-8484316 CCTGAAGGCAGAGTCCATACAAT No data
Right 1003702517 6:8484347-8484369 TACTGTTGTCCCTAACAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003702512 Original CRISPR ATTGTATGGACTCTGCCTTC AGG (reversed) Intergenic
No off target data available for this crispr