ID: 1003702513

View in Genome Browser
Species Human (GRCh38)
Location 6:8484308-8484330
Sequence ACAATGAAAGGAACATTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003702513_1003702517 16 Left 1003702513 6:8484308-8484330 CCATACAATGTTCCTTTCATTGT No data
Right 1003702517 6:8484347-8484369 TACTGTTGTCCCTAACAAAGTGG No data
1003702513_1003702515 -8 Left 1003702513 6:8484308-8484330 CCATACAATGTTCCTTTCATTGT No data
Right 1003702515 6:8484323-8484345 TTCATTGTATTATAAAATGAAGG No data
1003702513_1003702516 -7 Left 1003702513 6:8484308-8484330 CCATACAATGTTCCTTTCATTGT No data
Right 1003702516 6:8484324-8484346 TCATTGTATTATAAAATGAAGGG No data
1003702513_1003702518 20 Left 1003702513 6:8484308-8484330 CCATACAATGTTCCTTTCATTGT No data
Right 1003702518 6:8484351-8484373 GTTGTCCCTAACAAAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003702513 Original CRISPR ACAATGAAAGGAACATTGTA TGG (reversed) Intergenic
No off target data available for this crispr