ID: 1003702514

View in Genome Browser
Species Human (GRCh38)
Location 6:8484320-8484342
Sequence TCATTTTATAATACAATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003702514_1003702517 4 Left 1003702514 6:8484320-8484342 CCTTTCATTGTATTATAAAATGA No data
Right 1003702517 6:8484347-8484369 TACTGTTGTCCCTAACAAAGTGG No data
1003702514_1003702518 8 Left 1003702514 6:8484320-8484342 CCTTTCATTGTATTATAAAATGA No data
Right 1003702518 6:8484351-8484373 GTTGTCCCTAACAAAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003702514 Original CRISPR TCATTTTATAATACAATGAA AGG (reversed) Intergenic
No off target data available for this crispr