ID: 1003702517

View in Genome Browser
Species Human (GRCh38)
Location 6:8484347-8484369
Sequence TACTGTTGTCCCTAACAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003702514_1003702517 4 Left 1003702514 6:8484320-8484342 CCTTTCATTGTATTATAAAATGA No data
Right 1003702517 6:8484347-8484369 TACTGTTGTCCCTAACAAAGTGG No data
1003702512_1003702517 30 Left 1003702512 6:8484294-8484316 CCTGAAGGCAGAGTCCATACAAT No data
Right 1003702517 6:8484347-8484369 TACTGTTGTCCCTAACAAAGTGG No data
1003702513_1003702517 16 Left 1003702513 6:8484308-8484330 CCATACAATGTTCCTTTCATTGT No data
Right 1003702517 6:8484347-8484369 TACTGTTGTCCCTAACAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003702517 Original CRISPR TACTGTTGTCCCTAACAAAG TGG Intergenic
No off target data available for this crispr