ID: 1003704649

View in Genome Browser
Species Human (GRCh38)
Location 6:8511403-8511425
Sequence GGATTCTCCAGAAAGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003704649_1003704651 5 Left 1003704649 6:8511403-8511425 CCATGTTGCTTTCTGGAGAATCC No data
Right 1003704651 6:8511431-8511453 GTGACACTCAGTTTTCTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003704649 Original CRISPR GGATTCTCCAGAAAGCAACA TGG (reversed) Intergenic