ID: 1003706246

View in Genome Browser
Species Human (GRCh38)
Location 6:8534303-8534325
Sequence AGTTCTATGCAAGAGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003706246_1003706249 -5 Left 1003706246 6:8534303-8534325 CCCTCTACCTCTTGCATAGAACT No data
Right 1003706249 6:8534321-8534343 GAACTGCAACCACAAGACTATGG No data
1003706246_1003706251 15 Left 1003706246 6:8534303-8534325 CCCTCTACCTCTTGCATAGAACT No data
Right 1003706251 6:8534341-8534363 TGGAATGTGAACAGAACTGATGG No data
1003706246_1003706252 28 Left 1003706246 6:8534303-8534325 CCCTCTACCTCTTGCATAGAACT No data
Right 1003706252 6:8534354-8534376 GAACTGATGGATGTCTTTTCTGG No data
1003706246_1003706253 29 Left 1003706246 6:8534303-8534325 CCCTCTACCTCTTGCATAGAACT No data
Right 1003706253 6:8534355-8534377 AACTGATGGATGTCTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003706246 Original CRISPR AGTTCTATGCAAGAGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr