ID: 1003706831

View in Genome Browser
Species Human (GRCh38)
Location 6:8541800-8541822
Sequence CTATTCTACCAGGTATGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003706831_1003706833 16 Left 1003706831 6:8541800-8541822 CCAAAACATACCTGGTAGAATAG No data
Right 1003706833 6:8541839-8541861 ATACTGTAGCAGACAATACCAGG No data
1003706831_1003706836 27 Left 1003706831 6:8541800-8541822 CCAAAACATACCTGGTAGAATAG No data
Right 1003706836 6:8541850-8541872 GACAATACCAGGTGCCGGGTTGG No data
1003706831_1003706834 22 Left 1003706831 6:8541800-8541822 CCAAAACATACCTGGTAGAATAG No data
Right 1003706834 6:8541845-8541867 TAGCAGACAATACCAGGTGCCGG No data
1003706831_1003706835 23 Left 1003706831 6:8541800-8541822 CCAAAACATACCTGGTAGAATAG No data
Right 1003706835 6:8541846-8541868 AGCAGACAATACCAGGTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003706831 Original CRISPR CTATTCTACCAGGTATGTTT TGG (reversed) Intergenic
No off target data available for this crispr