ID: 1003706832

View in Genome Browser
Species Human (GRCh38)
Location 6:8541810-8541832
Sequence TTAACTTTAACTATTCTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003706832_1003706833 6 Left 1003706832 6:8541810-8541832 CCTGGTAGAATAGTTAAAGTTAA No data
Right 1003706833 6:8541839-8541861 ATACTGTAGCAGACAATACCAGG No data
1003706832_1003706835 13 Left 1003706832 6:8541810-8541832 CCTGGTAGAATAGTTAAAGTTAA No data
Right 1003706835 6:8541846-8541868 AGCAGACAATACCAGGTGCCGGG No data
1003706832_1003706836 17 Left 1003706832 6:8541810-8541832 CCTGGTAGAATAGTTAAAGTTAA No data
Right 1003706836 6:8541850-8541872 GACAATACCAGGTGCCGGGTTGG No data
1003706832_1003706837 21 Left 1003706832 6:8541810-8541832 CCTGGTAGAATAGTTAAAGTTAA No data
Right 1003706837 6:8541854-8541876 ATACCAGGTGCCGGGTTGGATGG No data
1003706832_1003706834 12 Left 1003706832 6:8541810-8541832 CCTGGTAGAATAGTTAAAGTTAA No data
Right 1003706834 6:8541845-8541867 TAGCAGACAATACCAGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003706832 Original CRISPR TTAACTTTAACTATTCTACC AGG (reversed) Intergenic
No off target data available for this crispr