ID: 1003706834

View in Genome Browser
Species Human (GRCh38)
Location 6:8541845-8541867
Sequence TAGCAGACAATACCAGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003706831_1003706834 22 Left 1003706831 6:8541800-8541822 CCAAAACATACCTGGTAGAATAG No data
Right 1003706834 6:8541845-8541867 TAGCAGACAATACCAGGTGCCGG No data
1003706832_1003706834 12 Left 1003706832 6:8541810-8541832 CCTGGTAGAATAGTTAAAGTTAA No data
Right 1003706834 6:8541845-8541867 TAGCAGACAATACCAGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003706834 Original CRISPR TAGCAGACAATACCAGGTGC CGG Intergenic
No off target data available for this crispr