ID: 1003706837

View in Genome Browser
Species Human (GRCh38)
Location 6:8541854-8541876
Sequence ATACCAGGTGCCGGGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003706832_1003706837 21 Left 1003706832 6:8541810-8541832 CCTGGTAGAATAGTTAAAGTTAA No data
Right 1003706837 6:8541854-8541876 ATACCAGGTGCCGGGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003706837 Original CRISPR ATACCAGGTGCCGGGTTGGA TGG Intergenic
No off target data available for this crispr