ID: 1003707939

View in Genome Browser
Species Human (GRCh38)
Location 6:8555681-8555703
Sequence CTCTGTAAGGAGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003707939_1003707947 9 Left 1003707939 6:8555681-8555703 CCCTCCACCTCCTCCTTACAGAG No data
Right 1003707947 6:8555713-8555735 TAGAGGAGAGACAGAGATAGTGG No data
1003707939_1003707949 19 Left 1003707939 6:8555681-8555703 CCCTCCACCTCCTCCTTACAGAG No data
Right 1003707949 6:8555723-8555745 ACAGAGATAGTGGACATGAAGGG No data
1003707939_1003707946 -8 Left 1003707939 6:8555681-8555703 CCCTCCACCTCCTCCTTACAGAG No data
Right 1003707946 6:8555696-8555718 TTACAGAGGCACATAAATAGAGG No data
1003707939_1003707948 18 Left 1003707939 6:8555681-8555703 CCCTCCACCTCCTCCTTACAGAG No data
Right 1003707948 6:8555722-8555744 GACAGAGATAGTGGACATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003707939 Original CRISPR CTCTGTAAGGAGGAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr