ID: 1003708200

View in Genome Browser
Species Human (GRCh38)
Location 6:8559263-8559285
Sequence CTACTTACAAAGGTGTAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003708193_1003708200 13 Left 1003708193 6:8559227-8559249 CCAATAGAGTAATTCAAAGAATA No data
Right 1003708200 6:8559263-8559285 CTACTTACAAAGGTGTAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003708200 Original CRISPR CTACTTACAAAGGTGTAGAT GGG Intergenic
No off target data available for this crispr