ID: 1003709883

View in Genome Browser
Species Human (GRCh38)
Location 6:8577323-8577345
Sequence CTCTCCATGGGGGTTTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003709876_1003709883 18 Left 1003709876 6:8577282-8577304 CCTAGAGAAGATGGAAATGACTT No data
Right 1003709883 6:8577323-8577345 CTCTCCATGGGGGTTTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003709883 Original CRISPR CTCTCCATGGGGGTTTTGAG GGG Intergenic
No off target data available for this crispr