ID: 1003710197

View in Genome Browser
Species Human (GRCh38)
Location 6:8580989-8581011
Sequence CTGGCTCTATATTTTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003710197_1003710199 -6 Left 1003710197 6:8580989-8581011 CCTTTAAAAAAATATAGAGCCAG No data
Right 1003710199 6:8581006-8581028 AGCCAGAAATAAATAAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003710197 Original CRISPR CTGGCTCTATATTTTTTTAA AGG (reversed) Intergenic
No off target data available for this crispr