ID: 1003714551

View in Genome Browser
Species Human (GRCh38)
Location 6:8631995-8632017
Sequence TGATCACAAGAGAGAGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003714551_1003714554 8 Left 1003714551 6:8631995-8632017 CCATTTCCTCTCTCTTGTGATCA No data
Right 1003714554 6:8632026-8632048 AATCCAGCCACCATATTGAAAGG No data
1003714551_1003714558 27 Left 1003714551 6:8631995-8632017 CCATTTCCTCTCTCTTGTGATCA No data
Right 1003714558 6:8632045-8632067 AAGGAAGCCCAAGAAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003714551 Original CRISPR TGATCACAAGAGAGAGGAAA TGG (reversed) Intergenic