ID: 1003714551 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:8631995-8632017 |
| Sequence | TGATCACAAGAGAGAGGAAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1003714551_1003714554 | 8 | Left | 1003714551 | 6:8631995-8632017 | CCATTTCCTCTCTCTTGTGATCA | No data | ||
| Right | 1003714554 | 6:8632026-8632048 | AATCCAGCCACCATATTGAAAGG | No data | ||||
| 1003714551_1003714558 | 27 | Left | 1003714551 | 6:8631995-8632017 | CCATTTCCTCTCTCTTGTGATCA | No data | ||
| Right | 1003714558 | 6:8632045-8632067 | AAGGAAGCCCAAGAAATCAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1003714551 | Original CRISPR | TGATCACAAGAGAGAGGAAA TGG (reversed) | Intergenic | ||